منابع پایان نامه درمورد حقوق و دستمزد، شناخت انسان، سطوح مهارت

مشاغل يك سازمان بدون آنكه عوامل تشكيل دهنده آن مشخص گردند، با يكديگر مقايسه مي شوند. مشاغل بر حسب درجه دشواري يا اهميت و نيز با توجه به معيارهاي ذهني ارزيابها، از پايين به بالا مرتب مي شوند و به ترتيب به گروه هاي شغلي پيش بيني شده، تخصيص مي يابند. به عبارت ديگر؛ پايين ترين شغل به گروه يك و مشاغل مهمتر در گروه هاي بالاتر قرار مي گيرند هزينه اين روش كم است و به دليل كيفي بودن، از دقت كافي در تجزيه و تحليل برخوردار نيست. يكي ديگر از معايب اين روش آن است كه به جاي ارزيابي يك شغل خاص، مشاغل سازمان مورد ارزيابي قرار مي گيرند. به هر حال. از اين روش
مي توان در سازمان هايي كه تعداد كاركنان آن كم است و مديريت سازمان نيز قادر به تأمين هزينه لازم براي بهره‌گيري از روشهاي پرهزينه‌تر نيست، استفاده كرد (قانوني، 1356).
2-نظام طبقه‌بندي40: اين روش تا حدودي از روش معروف به نظام رتبه‌بندي كاملتر است. در روش نظام طبقه بندي، كارشناس ارزشيابي شغل ضوابطي را براي ارزشيابي هر شغل به كار مي گيرد و طي آن موجباتي را فراهم مي آورد كه به ترتيب: 1)ابتدا كليه مشاغل سازمان مورد بررسي كلي قرار مي گيرند، 2)براي مشاغل مشابه، طبقات يا گروه هايي ايجاد شود، 3)براي هر طبقه يا گروه، شرحي تهيه گردد. بديهي است هرچه تنوع مشاغل يك سازمان بيشتر باشد، تعداد طبقات مشاغل نيز بيشتر مي شود. تعداد طبقات شغلي با توجه به ماهيت و سياست سازمان نيز تغيير مي كند. براي هر گروه از مشاغل، تعدادي ارزش پايه در نظر گرفته مي شود و همراه آن، براي هر گروه شغلي نيز تعدادي مشاغل نمونه انتخاب مي شوند تا از اين مشاغل نمونه به عنوان معياري براي سنجش ارزش ساير مشاغل، استفاده شود. در نظام طبقه بندي، همه مشاغل يك سازمان به طور مجزا مورد بررسي قرار مي گيرند و در گروه مربوط به خود، قرار داده مي شوند. هرچند روش نظام طبقه بندي از جمله روشهاي متداول ارزشيابي مشاغل غيركمي بودن آن است، از دقت و عينيت كافي برخوردار نمي باشد (جردن، 1986)،
سازمان امور اداري و استخدامي كشور نيز (قبل از ادغام با سازمان برنامه و بودجه و تشكيل سازمان مديريت و برنامه ريزي) براي طبقه‌بندي و ارزشابي مشاغل سازمان‌هاي مشمول قانون استخدام كشوري، از اين روش استفاده كرده و طي آن، كليه مشاغل مؤسسات دولتي را در بيست گروه، قرار داده است.
3-نظام مقايسه عوامل41: روش مقايسه عوامل براي اولين بار در سال 1926 به وسيله بنج42 ارائه و بعد توسط بورك و هي43 كاملتر شد. روش مقايسه عوامل يكي از شيوه هاي گسترده و كاملتر رتبه‌بندي و طبقه‌بندي مشاغل است و از دو روش كيفي قبلي، پيچيده تر مي باشد، روش مقايسه عوامل كه به نظام مشاغل كليدي نيز معروف است، در تعداد معدودي از سازمانها مورد استفاده قرار مي گيرد (سينگر44، 1990).
مراحل پنجگانه ارزشيابي شغل با استفاده از روش مقايسه عوامل عبارتند از:
1-3: روش انتخاب مشاغل نمونه يا كليدي: در مرحله نخست، كميته اي مركب از نمايندگان طبقات مختلف سازمان، تعدادي مشاغل نمونه را از كليه تخصص ها و رده‌هاي مختلف، انتخاب مي كنند. انتخاب اين مشاغل بر اساس مشخص بودن وظايف و مسئوليتها، ثبات نسبي وظايف و عادلانه بودن حقوق و دستمزد پرداختي به متصديان اين مشاغل، انجام مي گيرد. از مشاغل نمونه (استاندارد) كه بدين ترتيب انتخاب شده اند، به عنوان راهنما در ارزشيابي ساير مشاغل، استفاده مي شود.
2-3: تعيين عوامل مشاغل نمونه: مشاغل نمونه انتخاب شده، بر اساس شرح شغل آنها و احتمالاً مصاحبه و مشاهده، مورد تجزيه و تحليل كارشناسان قرار مي گيرند و عوامل اصلي تشكيل دهنده اين مشاغل، تعيين مي گردد. عوامل انتخاب شده براي هر شغل (مانند مهارت، مسئوليت، محيط و…) كه تعداد آنها نيز معمولاً بين 4 تا 7 عامل است، تعريف مي شوند.
3-3: تعيين ترتيب تقدم هر شغل بر حسب هر يك از عوامل: در اين مرحله، مشاغل نمونه بر اساس يك‌يك عوامل انتخاب شده و به ترتيب اهميت تنظيم مي شوند و نتايج اين مقايسه در جدولي كه براي همين منظور تهيه شده است، وارد مي شود. چون مشاغل نمونه با توجه به عوامل انتخاب شده در درجات مختلف قرار مي گيرند، بنابراين، ترتيب تقدم آنها با يكديگر، متفاوت خواهد بود.
4-3: تعيين ارزش پولي عوامل: در اين مرحله و بعد از آن خط مشي سازمان در مورد حقوق و دستمزد كاركنان روشن شد. به هر يك از عوامل مشاغل انتخاب شده، ارزش پولي مناسبي اختصاص داده مي شود و بر اساس مجموع ارزش پولي عوامل هر شغل، حقوق يادستمزد پايه آن شغل، مشخص مي گردد.
5-3: ارزشيابي ساير مشاغل از طريق مقايسه عوامل آنها با عوامل مشابه در مشاغل نمونه: در اين مرحله، ساير مشاغل سازمان با مشاغل نمونه مقايسه مي شوند و ارزش آنها بر اساس تطبيق هر يك از عوامل انتخاب شده با يكي از مشاغل نمونه، مشخص مي گردد.
4-نظام امتيازي45: روش معروف نظام امتيازي جديدترين و كاملترين راهبرد ارزشيابي مشاغل است. اين روش اولين باردر سال 1935 به وسيله لات46 ارائه گرديد و مورد استقبال فراوان قرار گرفت. لازمه بهره گيري از اين روش، تجزيه و تحليل شغل و شناخت عوامل اصلي و اساسي آن (نظير مهارتها، مسئوليتها، محيط و…) و بعد تجزيه عوامل اصلي به حدود 10 تا 20 عامل فرعي است. براي اينكه ارزشيابي شغل با سهولت بيشتري انجام گيرد، مي توان عوامل فرعي را كاهش داد. اين روش بيشتر در موسسات صنعتي و كارخانه هاي توليدي كاربرد دارد و نظام ارزشيابي مورد عمل وزارت كار و امور اجتماعي در ايران ني
ز بر اساس اين روش تدوين شده است. در نظام امتيازي، ارزش نسبي مشاغل بر حسب مجموع امتيازهايي كه به عوامل شغل تعلق مي گيرد، تعيين مي شود (فليپو47، 1984).
ر- هدايت و اثر گذاري (رهبري)
ظهور رهبري به شروع زندگي اجتماعي انسان باز مي گردد. وقتي دو يا چند نفر تشکيل يک گروه اجتماعي را مي دهند و با يکديگر رابطه برقرار مي کنند، تأثيري که افراد اين گروه روي يکديگر مي گذارند يکسان و برابر نيست. بلکه بعضي از افراد نقش فعال تري به خود گرفته و تاثير بيشتري روي ديگران
مي گذارد بطوري که بيش از ديگران در گروه مورد توجه قرار مي گيرند و اين زمينه آغاز پيدايش رهبري در گروه است. ظهور رهبران در مجموعه هاي انساني اعم از گروه، سازمان، ملت و جامعه جهاني وقتي بيشتر احساس مي شود که اين مجموعه ها با مسائل، مشکلات، بحران ها و فشارهاي داخلي و خارجي مواجه گردند. ظهور رهبري در گروه ها، تا حدودي به وجود افراد داراي استعداد رهبري نيز بستگي دارد. در صورتي که يک گروه اجتماعي از نظر داشتن چنيني افرادي غني باشد و افراد زيادي شايستگي احراز مسئوليت هاي بزرگ را دارد، راه حل آن در جهت يک رهبري دسته جمعي و يا توزيع رهبري بين افراد داراي صلاحيت است. برعکس چنانچه گروهي فاقد فرد يا افراد واجد استعداد براي قبول مسئوليت ها باشند، ممکن است از هم پاشيده شود و نتواند به حيات خود به عنوان يک مجموعه ادامه دهد. در حقيقت يک مجموعه انساني نه پيروان بدون رهبر امکان حيات خواهد داشت و نه رهبران بدون پيروان (جاسبي، 1379).
1-الگوي فيدلر
اولين الگوي جامع اقتضائي درباره رهبري را فرد فيدلر48 ارائه كرد. الگوي موقعيتي فيدلر نشان
مي دهد كه عملكرد موفقيت آميز گروه بستگي به تناسب و هماهنگي موجود بين شيوه تعامل رهبري با كاركنان و درجه اي كه آن موقعيت به رهبر اجازه كنترل و اثربخشي مي دهد، دارد. فيدلر پرسشنامه ناخوشايندترين همكار49 را ارائه كرده كه مدعي سنجش اين امر است كه آيا يك فرد وظيفه گراست يا رابطه گرا. به عبارت بهتر، او سه معيار را مجزا كرد كه به نظرش مي تواند بين رفتار رهبر و شرايط موجود توازن برقرار كند. به نوعي، الگوي فيدلر نظريه ويژگي رشد يافته است، گرچه پرسشنامه LPC يك آزمون ساده روانشناسي است ولي فيدلر پا را از حد تئوري هاي رفتاري و شخصيتي فراتر گذاشت و به عامل شرايط و موقعيت ها هم توجه كرد. او فرد را در رابطه با وضع يا موقعيتي خاص مورد توجه قرار داد و سپس در صدد برآمد تا اثر بخشي رهبر را به عنوان تابعي از اين دو عامل درآورد.
فيدلر بر اين باور است كه عامل كليدي در موفقيت رهبري شيوه اصلي رهبري فرد است. بنابراين وي مي كوشد تا دريابد كه اين شيوه اصلي چيست؟ فيدلر براي دست يابي به اين هدف پرسشنامه LPC را تهيه كرد (استيفن پي رابينز50، 1943؛ به نقل از اعرابي، 1384).

2- نظريه مسير- هدف
يكي از ارزشمندترين نگرش ها به موضوع رهبري، نظريه مسير- هدف مي باشد. اين نظريه را رابرت هاوس51 ارائه كرد و گونه اي از الگوي اقتضايي رهبري است كه گلچيني از عناصر كليدي پژوهش هاي مربوط به رهبري – دانشگاه اوهايو- و نظريه انگيزشي انتظار را در خود دارد.
اساس اين نظريه اين است كه وظيفه رهبر اين است كه پيروانش را در دستيابي به اهداف كمك كند و رهنمودها و حمايت هاي لازم را تدارك ببيند تا اين اطمينان را ايجاد نمايد كه اهداف آنها با اهداف كلي گروه يا سازمان سازگار مي باشد. اصطلاح مسير- هدف از اين باور ريشه گرفته است كه رهبران كارآمد مسير را براي كمك به پيروانشان صاف مي كنند تا بدانند كه در چه مرحله اي از مسير دستيابي به اهداف كاري شان قرار گرفته اند با برطرف كردن موانع و مشكلات، پيمودن مسير را آسان تر مي نمايند. بر اساس اين نظريه، رفتار رهبر تا آن درجه براي كاركنان قابل قبول است كه بتواند موجبات رضايت آنها را در حال و آينده تامين نمايد (استيفن پي رابينز، 1943؛ به نقل از اعرابي، 1384).
3- الگوي رهبري مشاركتي
ويكتور روم52 و فيليپ يتان53 (1973) الگوي رهبري مشاركتي را ارائه كردند كه اين الگو رفتار رهبري را با مشاركت در تصميم گيري مرتبط نمود. اين الگو نشان مي دهد كه ساختارهاي كار براي فعاليت هاي يكنواخت و متغير، متفاوت هستند، اين پژوهشگران معتقد بودند كه رفتار رهبر بايد بازتاب ساختارهاي كار باشد (ساعتچي، 1386).

4- نظريه رهبري كاريزماتيك
نظريه رهبري كاريزماتيك54 حاصل بسط نظريه اسنادي است. اين نظريه مي گويد كه پيروان (زيردستان) به هنگامي كه رفتارهاي خاصي را مي بينند، توانايي هاي خارق العاده يا قهرمانانه اي را به رهبر نسبت مي دهند (کريمي، 1382).

پيشينه عملي پژوهش:
الف- تجزيه و تحليل شغل
نتايج تحقيقات انجام شده حاكي از آن است كه، تناسب شغلي (متغير مستقل) در عملكرد افراد و ايجاد رضايت شغلي (متغير وابسته) موثر است كه اين يافته ها طبعا خيلي ادعاي تازه اي نيست، ولي در مورد اينكه شخصيت ذاتي و ارثي است يا شخصيت افراد قابل تغيير است و يا اصولا چند نوع شخصيت وجود دارد و هر نوع داراي چه ويژگي هايي است، و مشاغل مناسب براي هر يك از انواع شخصيت كدامند؟ وفاق عمومي وجود ندارد (ميرسپاسي، 1378).
در آگوست سال 2000 سازمان بين المللي انرژي اتمي سندي را به شماره IAEI-TECDOC 1170 منتشر نمود كه در آن، چارچوب “رويكرد سيستماتيك به آموزش” يا 55SAT بيان شده بود. حوزه كاربرد آن، پرسنل نيروگاه هاي هسته اي در سراسر دنيا بود. بر اين اساس رويكرد نظام مند به مقوله آموزش داراي پنج فاز است:
1- تجزيه و تحليل
2- طراحي
3- توسعه
4- به كارگيري
5- ارزشيابي
در سند مذكور تاكيد بر فاز اول، تجريه و تحليل مي باشد. فاز تجزيه و تحليل، شامل تعيين دانش مخصوص كار، مهارت و ويژگيهاي شاغل براي انجام موفقيت آميز شغل است. همانگونه كه از مطالب ذكر شده در رابطه با اين سند مشخص است، SAT روشي براي نيازسنجي و طراحي دوره هاي آموزشي براي پرسنل نيروگاه هاي هسته اي مي باشد، كه توسط سازمان بين المللي انرژي اتمي مورد استفاده قرار گرفته است. به دليل اينكه در فاز اول SAT يعني تجزيه و تحليل، نياز به تعيين سطوح مهارتي مختلف براي انجام موفقيت آميز شغل وجود دارد، لذا از روشهاي تجزيه و تحليل مشاغل استفاده مي گردد.
با توجه به اينكه در فاز تجزيه و تحليل SAT ، اطلاعات لازم جهت انجام چهار فاز ديگر توليد مي شوند، لذا اين فاز اهميت ويژه اي در كيفيت و صحت خروجيهاي حاصله خواهد داشت. بنابراين انتخاب روش تجزيه و تحليل، از اهميت خاصي برخوردار است. بر اين اساس، روش تجزيه و تحليل مشاغل، روشي سيستماتيك است كه جهت تهيه فهرستي از وظايف يا شايستگيهاي لازم جهت انجام يك شغل ويژه، مورد استفاده قرار مي گيرد.
يك شغل را مي توان به چندين واحد عملياتي به نام حوزه هاي مسووليت تقسيم نمود. يك حوزه مسووليت، فعاليتي مشهود و عمده مي باشد كه براي تخصيص شغل به انجام مي رسد. يك وظيفه واحدي قابل اندازه گيري و كاملا تعريف شده از كار مي باشد كه شروع و پايان آن قابل تشخيص مي باشد (مدني،1385).
روش تحليل وظيفه شغلي (JTA)56
نيروي دريايي ايالات متحده از روشي تحت عنوان تجزيه و تحليل وظيفه شغل (JTA) جهت تعيين مشاغل، مسووليتها و وظايف كاركنان خود استفاده مي كند. نرم افزار مورد استفاده جهت ايجاد خروجيها در اين تكنيك نرم افزار Cmap است كه تسهيل كننده برگزاري كارگاه هاي آموزش ساختار يافته و ترسيم نمودارهاي مفهومي و به كارگيري دانش مي باشد.
در سال 1978 وزارت كار ايالات متحده، تجزيه و تحليل شغل را جزءلاينفك رويه انتخاب شغل و شاغل لحاظ نمود. در سال 1991 اين وزارتخانه با تصويب قانون ADA 57 (شهروندان معلول آمريكايي) استانداردها و خطوط راهنماي لازم جهت انتخاب شاغلين را فراهم كرد. جهت تامين نيازهاي استاندارد وزارت كار ايالات متحده روشهاي مختلفي براي تجزيه و تحليل شاغل وجود دارد. يكي از اين روشها فرايند تجزيه و تحليل وظايف شغلي است كه توسط نيروي دريايي ايالات متحده به كار گرفته شده است.
در سال 1997، مركز آموزشهاي دريايي ايالات متحده كار مشتركي را با موسسه شناخت انسان ماشين (IHMC)58 در رابطه با مدل سازي دانش با استفاده از تكنيكهاي شبكه آغاز نمود. ايده اوليه اين كار تحقيقاتي، برمبناي تئوري ترسيم و يادگيري مفهوم ، ارايه شده توسط نوواك59 در سال 1978 و 1984 بنا شده بود. در سال 1999 اين پروژه با همكاري نوواك پيشرفت نمود و منجر به ايجاد نرم افزار آزمايشي با ساختار از بالا به پايين گرديد. در سال 2002 الگوي طراحي شده اوليه توسط تيم پروژه براي گردآوري و ترسيم نظرات گروه خبرگان موضوع مورد استفاده قرار گرفت و جهت نمايش مفاهيم به صورت تصويري، نرم افزار Cmap توسط تيم پروژه توسعه پيدا كرد.
در سال 2004 جان كافي60 نشان داد كه تصميمات اخذ شده با استفاده از تكنولوژي هاي كار

منابع پایان نامه درمورد حقوق و دستمزد، داده ها و اطلاعات، رفتار کارکنان، عملکرد کارکنان

گلدشتاين (1991) چنين مي گويد كه اعتبار هر برنامه آموزشي در امتداد چهار بعد مي تواند اندازه گيري گردد:
1. اعتبار آموزشي: آيا آموزش بينندگان با ملاك هاي ايجاد شده براي آنها در برنامه آموزشي جور شده اند؟ اين بعد با آنچه كه كرك پاتريك28 (1976) به عنوان ملاك دروني به آن اشاره مي كند مربوط است و به ميزان تسلط يافتن آموزش بيننده در آموزش مي پردازد.
2. اعتبار انتقال: آيا آموزش بينندگان هنگامي كه به شغل بر مي گردند با ملاك موفقيت جور شده اند؟ اين بعد ملاك بيروني را شامل مي گردد و به ميزان افزايش عملكرد كاركنان در شغل توسط آموزش
مي پردازد.
3. اعتبار درون سازماني: آيا برنامه آموزشي داراي اثربخشي يكساني براي گروه هاي مختلف آموزش بينندگان در درون يك سازمان بوده است؟ اين بعد با تعميم پذيري دورني آموزش مربوط است، از قبيل اثربخشي آموزش حساسيت براي كاركنان فروش در برابر توليد در يك سازمان.
4. اعتبار بين سازماني: آيا برنامه آموزشي داراي اثر بخشي يكساني بر آموزش بينندگان مختلف در سازمان هاي متفاوت بوده است؟ اين بعد تعميم پذيري بيروني آموزش را شامل مي شود؛ يعني اينكه به همان ميزاني كه يك برنامه آموزشي براي يك سازمان توليدي موفقيت آموز بوده است براي يك سازمان مالي نيز موفقيت آميز باشد.
د- ارزيابي عملکرد کارکنان
ويژگي هاي يک سيستم ارزيابي عملکرد مناسب به شرح زير است:
– از اهداف استراتژيک پشتيباني کند: سيستم هاي ارزيابي عملکرد بايد از اهداف استراتژيک نشات گرفته باشند. در غير اينصورت اين سيستم ممکن است فعاليتهايي را پشتيباني کند که اثر معکوس بر اهداف استراتژيک بگذارد بعلاوه بايد به اين نکته توجه کرد که اگر در طول زمان، استراتژيها تغيير يابند، برخي شاخص هاي عملکرد نيز تغيير خواهند کرد. در نتيجه نياز به انعطاف پذيري در اين سيستم ها احساس مي شود تا بتوان از اين طريق اطمينان حاصل نمود که سيستم ارزيابي عملکرد هميشه با اهدف سازمان سازگار است.
– متوازن باشد: اين موضوع که سيستم ارزيابي عملکرد نبايد تنها از نقطه نظر مالي ديده شود بسيار حياتي است. يک سيستم ارزيابي عملکرد بايستي انواع مختلفي از شاخص هاي عملکرد را شامل شود تا تمامي جنبه هاي مهم براي موفقيت سازمان را پوشش دهد. لذا بايستي بين شاخص هاي مختلف توازن وجود داشته باشد. يعني بصورت متناسبي بر روي نتايج کوتاه مدت و بلند مدت، انواع مختلف عملکرد (نظير هزينه، کيفيت، تحويل، انعطاف پذيري و …) جنبه هاي مختلف (نظير مشتريان، ذي نفعان، رقبا، نوآوري و …) و سطوح مختلف سازمان (نظير عملکرد کلي و بخشي) تمرکز داشته باشد.
– در مقابل بهينه سازي بخشي بايستد: ازآنجا که شاخص هاي عملکرد بر روي رفتار کارکنان اثر گذارند، مجموعه اي نامناسب از شاخص ها مي تواند به رفتارهاي غير کارکردي از طرف کارکنان منجر شود. به عبارت ديگر کارکناني که تنها در پي ارتقا و بهبود شاخص عملکرد مربوط به خود هستند، ممکن است تصميماتي بگيرند که در تضاد با خواسته هاي مديران باشد و بهبود در عملکرد واحد آنها به آسيب ديگر قسمت ها و يا حتي عملکرد کلي سازمان منجر شود. يک سيستم ارزيابي عملکرد بايد از اينگونه بهينه سازي ها جلوگيري کند.
– تعداد شاخص هاي عملکرد آن محدود باشد: براي ايجاد عملکرد مناسب ضروري است که تعداد شاخص هاي عملکرد آن محدود باشند. افزايش تعداد شاخص ها نياز به زمان تحليل بيشتري دارند. گردآوري اطلاعاتي که از آنها استفاده اي نمي شود يک اتلاف تلقي مي گردد. بنابراين ضروري است که تنها داده اي که براي يک هدف خاص کاربرد دارند و هزينه گردآوري آنها از مزاياي مورد انتظارشان بيشتر نيست گردآوري شوند.
– دسترسي به آن آسان باشد: هدف يک سيستم ارزيابي عملکرد، دادن اطلاعات مهم در زمان مناسب و به شخص مناسب است. لذا نکته مهم درباره اين سيستم ها آن است که بايد به گونه اي طراحي شوند که اطلاعات آنها به راحتي بهبود يافته و در دسترس استفاده کنندگان قرار گيرد و قابل فهم باشد.
– شامل شاخص هاي عملکرد جامع باشد: يک شاخص عملکرد بايد هدف مشخص داشته باشد. بعلاوه ضروري است که يک غايت مشخص نيز براي هر شاخصي تعريف شود و چهارچوب زماني مشخص شود که در غالب آن بايستي به آن غايت نايل شد (کريمي، 1385).
شاخص هاي مورد استفاده اندازه گيري عملکرد بايد حداقل داراي مشخصات زير باشد :
الف) خاص و معين باشد: يعني شاخص، شاخص اندازه گيري عملکرد واحد مورد بررسي (شرکت، فرآيند، واحد و فرد) بوده و اختصاص به آن داشته باشد مثلاٌ شاخص افزايش يا کاهش توليد اساساً ارتباطي با عملکرد واحد کنترل کيفيت ندارد، بنابراين نمي تواند بعنوان شاخص اين واحد تلقي شود.
ب) قابل اندازه گيري باشد: هر شاخصي که شناسايي مي شود بايد قابل اندازه گيري و سنجش باشد و چنانچه نتوان شاخص را اندازه گيري کرد عملا نمي توان از آن استفاده کرد. مثلا ممکن است، شاخص روحيه کارکنان را نتوان اندازه گيري کرد، ولي مي توان نرخ ضايعات توليد را مورد سنجش قرار داد.
ج) قابل حصول و دست يافتني باشد: هدف گذاري براي شاخص بايد قابل حصول و دست يافتني باشد، از اين رو در هدف گذاري براي هر شاخص، بايد توجه داشت که اهداف تعيين شده قابل حصول باشد.
د) واقعي و حقيقي باشد: شاخص ها بايد با مأموريتها، وظايف واحدها و فرآيندها مرتبط باشند. از سوي ديگر، در شناسايي شاخص ها لزوماً تعداد و کميت آنها مهم نيست، بلکه کيفيت شاخص ها نکته بسيار مهمي است که بايد ب
ه آن توجه داشت.
ه) داراي محدوده زماني معيني باشد: هر شاخص بايد در يک محدوده يا بازده زماني مورد سنجش و ارزيابي قرار بگيرد، در اين ميان محدوده زماني شاخص ها به عوامل متعددي مثل نوع و ماهيت شاخص ، ارتباط آن با ساير شاخص ها، وجود يا عدم وجود اطلاعات مورد نياز، فواصل جمع آوري و استخراج داده ها و اطلاعات مورد نياز و … ارتباط دارد.
و) وجود اطلاعات مورد نياز براي سنجش و اندازه گيري شاخص ها: هر شاخص زماني مفيد و مطلوب است که اطلاعات و داده هاي مورد نياز، براي سنجش و اندازه گيري آنها در اختيار باشد (اميران، 1387).
برخي از مشکلات مربوط به اندازه گيري عملکرد عبارتند از:
الف)فقدان معيارهاي متوازن و هماهنگ و سازگار با هم که خوب فرموله نشده.
ب) عدم دقت در تدوين شاخص ها و در نتيجه از بين رفتن کارايي شاخص ها و سيستم اندازه گيري عملکرد.
ج) فقدان هر يک از ويژگي هاي زير:
– عدم تمايل قلبي مديران و فقدان مشارکت جدي آنها در اين برنامه ها
– عدم وجود و يا جمع آوري اطلاعات دقيق و قابل اعتماد
– تحميلي بودن شاخص ها و روشهاي اندازه گيري عملکرد
– وجود اختلاف بين افراد مسئول اندازه گيري عملکرد، در تفسير و استراتژي سازمان.
ه) اهميت دادن به معيارهاي غير مالي
و) عدم وجود زبان مشترک بين اعضاي تيم اندازه گيري عملکرد (اميران، 1387).
ارزشيابي عملكرد، مي تواند كيفيت تصميمات افراد را افزايش دهد، اين تصميمات از انتخاب هاي حرفه تا توسعه نيرمندي هاي آتي ادامه دارد. بازخورد صحيح از عملكرد، مؤلفه بسيار مهم موفقيت آموزشي بوده و درون داد حساس و اساسي را براي شكل گيري خود ارزيابي هاي واقعي در محيط كار فراهم
مي كنند. بازخورد عملكرد، يك عامل اصلي نگهداري انگيزش كاري در سطح بالا مي باشد. ارزشيابي عملكرد، مي تواند ديدگاه كاركنان و چسبيدگي آنها را به سازمانشان تحت تاثير قرار دهد. موفقيت سيستم ارزشيابي عملكرد يك سازمان مي تواند به ايجاد تعهد و خشنودي كاركنان كمك كند. كاركناني كه اعتقاد دارند تصميمات سازمانشان غير منطقي و ناعادلانه است، غير محتمل است كه تعهد قوي به سازمانشان پيدا كنند. سرانجام، ارزشيابي رسمي عملكرد مبنايي منطقي و قانوناً قابل دفاع براي تصميمات مربوط به كاركنان فراهم مي كند (مهداد، 1386).

هـ- مشوق هاي مالي و ارزشيابي مشاغل
لولر29 (1371) معتقد است که پرداخت پول به دلايل مختلف، باعث افزايش اثر بخشي سازماني
مي شود، به عنوان يک پاداش تلقي مي گردد و بنابراين موجبات رضايت شغلي کارکنان را فراهم مي آورد، آنان را براي کارکردن بر مي انگيزد، تعهد افراد را نسبت به سازمان محل کار خود مي افزايد و باعث مي شود افراد در سازمان باقي بمانند.پول مي تواند در اصل نيازهاي فرد را به مورد احترام بودن ارضا کند و نيز بعنوان وسيله اي براي ارضاي نياز وي به استقلال و ايمني بکار رود. ضمناٌ پول مي تواند تا حدودي در ارضاي نياز اجتماعي افراد و نياز آنان به خود شکوفايي، موثر واقع شود ( ساعتچي، 1386).
اپساهل و دنت30 (1966) مي گويند بطور شگفت انگيزي اطلاعات و دانش ما در اين زمينه که آيا پول در رابطه متقابل با عوامل ديگر، يا به تنهايي، باعث افزايش عملکرد شغلي افراد مي گردند، اندک است (مهداد، 1386).
استال31 (1976) معتقد است خط و مشي مديريت سازمان، نگرش کارکنان، ماهيت فرهنگ سازماني و ارزش هاي مورد پذيرش کارکنان، تمايل مديريت براي جذب افراد شايسته به سازمان و عوامل درون سازماني ديگر، در تعيين حداقل حقوق و دستمزد و انواع پرداخت ها به کارکنان، موثر هستند (عباس زادگان، 1371).
در نظريه چند عاملي بهره وري و بويژه در مناباماس اين اعتقاد وجود دارد که قبل از اينکه در زمينه آزمايش متصديان مشاغل يک سازمان اقدامي انجام دهيم، ابتدا بايد با بهره گيري از روش هاي خاص، مشاغل مورد نظر را ارزشيابي کنيم و بر اساس آن، ميزان حقوق و دستمزد متصدي هر شغل را در آغاز ورود به سازمان و همچنين ميزان حقوق پرداختي به آنان را در فواصل زماني معين، در صورت نشان دادن پيشرفت در کار، مشخص سازيم. آگاهي از ميزان حقوق و دستمزد متصدي هر شغل لازمه تصميم گيري مديريت براي انجام افراد و تصميم گيري فرد يا افراد انتخاب شده جهت پيوستن يا نپيوستن به سازمان است (ساعتچي، 1386).
دستمزد32 پرداخت منظم مبلغ معيني به متصدي شغل در مقابل يا براي جبران كار يا خدمتي كه ارائه مي دهد. اين مبلغ ممكن است در مقابل چند ساعت، يك روز يا ميزان مشخصي از كار، پرداخت شود. به بيان ديگر، دستمزد عبارت است از پرداخت نقدي كه براي انجام دادن كارهاي اصطلاحاً “يدي” و به طور روزانه يا هفتگي، به كارگران داده مي شود. معني ديگر دستمزد، “مبلغ مورد پرداخت” است.
حقوق33 مبلغ پرداختي منظم و ثابت به متصدي يك شغل براي جبران كار يا خدماتي كه در يك دوره معين و غالباً طي يك ماه، انجام داده است.
رابطي (1377) مديريت حقوق و دستمزد را چنين تعريف مي كند: برقراري نوعي رابطه منطقي بين وظايف و مسئوليتهاي شغلي متصديان مشاغل گوناگون يك سازمان و ميزان حقوق و دستمزد پرداختي به آنان و همچنين به فعاليتهايي كه در زمينه تعيين حقوق و گاه پرداخت حقوق در يك سازمان انجام مي گيرد، اداره امور حقوق34 گفته مي شود.
با توجه به ويژگيهايي كه براي يك نظام پرداخت كارآمد شناخته شده است، اكنون مي دانيم عوامل موثر در تعيين حقوق و دستمزد متعدد هستند و اين عوامل نيز بر يكديگر اثر متقابل دارند
. بنابراين، در طراحي نظام حقوق و دستمزد بايد عوامل بسياري نظير ارزش نسبي شغل در سازمان، ارزش نسبي تخصصي كاركنان، سطح حقوق و دستمزد رايج در صنعت، نقش اتحاديه ها و سنديكاهاي كارگري، اوضاع و احوال و شرايط اقتصادي، سياسي و نظاير آن، مورد توجه قرار گيرد.
مراحل گوناگون فرايند طراحي نظام حقوق و دستمزد
1-تجزيه و تحليل شغل35: تجزيه و تحليل شغل فرايندي است كه طي آن وظايف شغلي متصديان هر يك از مشاغل سازمان و ويژگيهاي شخصيتي (شناختي، هيجاني و حركتي) لازم براي انجام دادن اين وظايف، مشخص مي گردد. بنابراين، مقدمه و لازمه تعيين حقوق و دستمزد، تجزيه و تحليل مشاغل يك سازمان است.
2-شرح شغل36: به خلاصه اي از اطلاعات مربوط به يك شغل خاص كه معرف آن باشد، شرح شغل يا شرح وظايف گفته مي شود. در شرح شغل، اطلاعاتي نظير شرح هدف، گستردگي وظايف، ارتباطهاي سازماني، مسئوليتها و انواع وظايف متصدي يك شغل خاص، آورده مي شود.
3-تعيين مشخصات شغل37: به شرح ويژگيهاي شخصيتي مورد نياز براي انجام دادن وظايف يك شغل خاص، شرايط احراز شغل گفته مي شود. در اين شرح، اطلاعاتي در زمينه مهارت ها، تجربه، استعداد و بالاخره ويژگي هاي شخصيتي فردي كه براي تصدي يك شغل معين مورد نياز مي باشد، آورده مي شود. در شرايط احراز شغل، اطلاعات حاصل از تجزيه و تحليل شغل و شرح شغل ارائه مي گردد و شرايط لازم يا ويژگي هاي فردي توصيف مي شود كه بتواند وظايف شغل مورد نظر رات به بهترين وجه و مطابق با ميزان هاي كاري پذيرفته شده، انجام دهد.
4-طبقه طبقه بندي مشاغل38: در تلاش جهت طبقه بندي مشاغل يك سازمان، مشاغلي كه داراي صفات و ويژگي هاي مشترك هستند در يك طبقه قرار مي گيرند. بنابراين، در طرح طبقه بندي مشاغل يك سازمان، طبقات يا دسته بنديهايي از تعدادي شغل را خواهيم داشت كه از جهات گوناگون، با هم مشابهت‌هايي دارند. طبقه بندي مشاغل يك سازمان در شرايطي امكان پذير است كه ابتدا با تجزيه و تحليل اين مشاغل، “شرح شغل” و “شرايط احراز شغل” را براي همه مشاغل موجود در آن سازمان، روشن ساخته باشيم (ابطحي، 1372).
5-ارزشيابي شغل39: به روشي نظامدار كه هدف آن تشخيص و تعيين ارزش نسبي يك شغل (در مقايسه با مشاغل ديگر يك سازمان) باشد، “ارزشيابي شغل” گفته مي شود. در ارزشيابي شغل، مفاهيمي نظير ارزش نسبي تعدادي از مشاغل يك سازمان، پيچيدگي وظايف شغلي، ميزان آموزش يا تجربه مورد نياز متصدي شغل و ميزان خسارت سازمان (در صورت درست انجام نگرفتن وظايف شغلي)، مورد توجه قرار مي گيرند (فرنچ و ساوارد، 1371).
ارزش نسبي يك شغل با توجه به سهمي كه آن شغل در بهره وري سازماني يا سهم يك شغل در موفقيت سازماني را نمي توان به سادگي محاسبه كرد، بنابراين لازم است از شاخص ها و متغيرهاي ديگري براي اين منظور، استفاده كنيم. در ارزشيابي شغل، متغيرهايي نظير مسئوليت، مهارت، تلاش، شرايط كار و نيز بهره‌گيري از نتايج حاصل از تجزيه و تحليل شغل و تعيين متغيرهاي مهم يك شغل، استفاده مي شود (موريس، 1366).
روشهاي ارزشيابي شغل
در ارزشيابي مشاغل يك سازمان، از چهار نظام اصلي، يعني، 1)نظام رتبه بندي، 2)نظام طبقه بندي، 3)نظام مقايسه عوامل، 4)نظام امتيازي، استفاده مي شود.
1-نظام رتبه بندي: در اين روش- كه به عنوان ابتدايي ترين و ساده ترين روش شناخته مي شود – كليه

منابع پایان نامه درمورد آموزش ضمن خدمت، ابزار توسعه، چرخه عمر، ضمن خدمت

تكاپوست، يكي از اهداف استراتژيك و بلند مدت مديران بلندپايه آن، رها نمودن اقتصاد كشور از درآمدهاي نفتي و اتكاء به درآمدهاي غيرنفتي به عنوان مهمترين منبع درآمد و موثرترين ابزار توسعه مي باشد. در اين راستا آموزش نيروي انساني و ارزيابي آثار آن بر افزايش عملكرد آنان، فوق العاده حايز اهميت است. آموزش صحيح نيروي انساني، ضمن اينكه در سطح سازمان هاي دولتي باعث ارتقاء عملكرد كاركنان و سازمان مي گردد زمينه هاي برخورد مناسبتر كاركنان با مراجعان را نيز فراهم مي نمايد. رابطه اي كه متأسفانه هنوز از جايگاه مطلوبي برخوردار نيست. آموزش، نيروي انساني را براي رسيدن به اهداف و مأموريت هاي سازمان تقويت مي نمايد. آموزش ضمن خدمت، در افزايش مهارت هاي شغلي نيروي انساني اعم از مديران و كاركنان موثر است. همچنين اين آموزشها حيطه دانش و معلومات مربوط به وظيفه كاركنان را گسترش مي بخشد و برمهارت هاي شغلي آنان مي افزايد (رضايي، 1377).
در دوران معاصر كمتر كسي يافت مي شود كه در خصوص لزوم و ضرورت وجود نظام ارزيابي عملكرد در سازمان، ترديد داشته باشد؛ لكن توسعه و گسترش دانش مديريت به صورت عام و حوزه مديريت منابع انساني به طور خاص، نوآوري و تغيير در فرايند ارزيابي عملكرد را اجتناب ناپذير كرده است. اين تحولات در زمينه هاي مختلف از قبيل شاخص ها، معيارها، نحوه نگرش به ارزيابي و … جلوه كرده است.
از ديدگاه سنتي، ارزيابي وسيله اي براي قضاوت و يادآوري عملكرد بوده، هدف اصلي آن كنترل فعاليتها و كاهش انحراف از برنامه ها بوده است. در ديدگاه نوين (كه پويايي وجه مميز و اصلي آن مي باشد) جهت گيري عمده و اساسي نظام ارزيابي، معطوف به رشد و پرورش ارزيابي شونده مي باشد. همچنين در نگرش نوين ، عناصر وشاخصهاي نظام ارزيابي، بر خلاف ديدگاه سنتي ثابت و دائم نيستند. ملحوظ كردن متغيرهاي زمينه اي سازمان، مانند محيط، تكنولوژي ، اندازه، چرخه عمر، اهداف و استراتژيهاي سازمان در ارزيابي و تدوين شاخصهاي متغير به همراه وزن گذاري، منجر به شكل گيري نظام ارزيابي پويا مي شود؛ كه بعضاً عنوان “سنجش اقتضايي متعادل” به آن اطلاق شده است. كاركردهاي ارزيابي نيز در ديدگاه نوين دچار تغييرات اساسي شده است. افزايش شايستگي كاركنان به همراه ارائه بازخورد به آنها به منظور مشاوره شغلي و ابزاري براي عملي كردن استراتژيهاي سازمان در تحقق اهداف سازماني از جمله كاركردهاي نظام ارزيابي در ديدگاه نوين مي باشد. پذيرش محيط و قبول تاثيرات محيطي بر سازمان و پذيرش همكاريهاي مناسب از سوي سازمان، براي برقراري تعامل موثر با محيط از محورها و موضوعات ديگري است كه نظام ارزيابي پويا آن را مورد توجه قرار داده است.
اين ضرورت به گونه اي خود را نمايان ساخته، كه عدم وجود نظام ارزيابي به عنوان يكي از علايم بيماري سازمان شناخته شده است. با ملاحظه نظام آفرينش مي توان دريافت كه ارزيابي در بطن آن قرار دارد. خداوند متعال در قرآن كريم مي فرمايند: آنچه در آسمانها و زمين است ملك خداست و شما آنچه در دل داريد چه آشكار و چه پنهان كنيد، خداوند شما را با آن محاسبه مي كند. پس هر كس را كه بخواهد
مي آمرزد و هركس را بخواهد عذاب مي كند و خدا بر همه چيز تواناست.
توسعه، گسترش و تحولات دانش مديريت به صورت عام و حوزه مديريت منابع انساني به صورت خاص، باعث تغيير و تحول در نظام ارزيابي عملكرد شده است. بيان اصول قطعي و جهان شمول براي اداره سازمان از سوي كلاسيكها، توجه به انسان به همراه طراحي سازوكارهاي مناسب مديريتي متناسب با ويژگي هاي انسان از سوي نئوكلاسيكها، قائل شدن خاصيت تعاملي بين عناصر سازماني و توجه به آثار متقابل آنها به همراه كل نگري از سوي واضعان نظريه سيستمها و طرح نظريه اقتضايي در مديريت، مبني بر لحاظ شرايط در انتخاب و اعمال سازوكار مديريتي نشانگر سير تحول و تكامل نظريه هاي سازمان و مديريت است.
به تبع اين تحول، نظام ارزيابي عملكرد هم از نظر نگرش، ساز و كارها، شاخصها و …نيز دچار تغيير و تحول شده است. در اين مطالعه از نظريه اقتضايي به عنوان زيربناي مفهومي براي تبيين نگرش جديد به ارزيابي استفاده شده است. نظام ارزيابي معرف، پويا، كارآمد و متناسب با مجموعه شرايط سازمان الگويي است كه نويسندگان معتقدند سازمان ها بايستي به آن توجه لازم را بنمايند و به كارگيري آن را در دستور كار خود قرار دهند.
از دلايل توجه به نظام ارزيابي منعطف، چالشي شدن مديريت منابع انساني است. چالش فن آوري مديران الزاماً سازوكارهاي منعطف را براي اثربخشي فعاليتها طلب مي كند. تغيير در تركيب نيروي كار (از حيث سطح تحصيلات، مهارتها و ورود زنان به بازار كار و …) و تغيير در ارزشهاي نيروي كار (از حيث ساعات انجام كار شناور و تامين نيازهاي ثانويه و …) و تغيير در تقاضاي كارفرمايان (به صورت ايجاد سازمان هاي عظيم ملي و بين المللي، اتوماسيون و برجسته شدن نقش خدمات و …) و الزامات دولتي (به صورت وضع قوانين و مقررات مربوط به استخدام، اخراج و …) منجر به چالشي شدن حوزه منابع انساني شده است كه به تبع آن نظام ارزيابي عملكرد نيز به عنوان نظام فرعي حوزه منابع انساني، متاثر از اين چالش مي باشد. (طبرسا، 1377).
امروزه شاهد تغييرات اساسي و سريع در جوامع و سازمان ها هستيم. اين تغييرات در ابعاد مختلف فرهنگي، اقتصادي، اجتماعي، سياسي، توانايي ها و تمايل انسان ها و تکنولوژي مي باشد. محققان و مديران جوامع و سازمان هاي پيشر
فته به اين نتيجه رسيده اند که مهمترين عامل موثر در تغييرات، رشد و توسعه سازمانها، برنامه ريزي و آموزش توانايي هاي نيروي انساني و توسعه فرهنگ جامعه و سازمان هاي آن است؛ در واقع نيروي انساني عاملي استراتژيک تلقي مي شود براين اساس؛ مديريت منابع انساني که در گذشته نه چندان دور اهميت چنداني براي آن قائل نبودند، امروزه به عنوان مهمترين دانش در سازمان ها و مجموعه مهارتهاي مديران در نظر گرفته مي شود. مديران پرسنلي در محدوده وظايف خود بايد به جذب و گزينش نيروي انساني مناسب بپردازند، برنامه هاي آموزش و پرورش نيروي انساني را تدوين کنند، سطح انگيزه کارکنان را بهبود دهند، کارکنان شايسته را حفظ و براي تامين نيازهاي آنها اقدام نمايند. مديران پرسنلي براي انجام وظايف اجرايي مذکور بايد وظايف مديريتي را نيز انجام دهند. هرمديري بايستي انجام دادن چهار وظيفه عمده مديريت يعني برنامه ريزي، سازمان دهي، رهبري و نظارت را در سرلوحه کارهاي خويش قرار دهد. در واقع مديران پرسنلي وظايف مديريتي و اجرايي را به عهده دارند. آنها براي تحقق اهداف سازماني و انجام وظايف اجرايي خود بايد برنامه ريزي نمايند، به سازماندهي وظايف و فعاليت هاي واحد پرسنلي بپردازند، افراد تحت سرپرستي خود را هدايت و رهبري نمايند و براي حصول اطمينان از عملکرد واحد پرسنلي به نظارت بر افراد و انجام چگونگي فعاليت ها بپردازند. مديران پرسنلي با انجام صحيح و کامل وظايف مديريتي مذکور مي توانند در انجام وظايف اجرايي در قلمرو واحد خود موفق گردند. با توجه به اينکه زيرمجموعه هاي نظام مديريت منابع انساني در هر سازمان و موسسه به طور زنجيروار به يکديگر مرتبط بوده و تعامل مستمر دارند لذا هر يک از فرايندهاي مربوط به شغل و شاغل بايد به طور متناسب و متوازن در نظر گرفته شوند، در غير اينصورت حتي اگر نيروي انساني جذب شده، آموزش ديده، مهارت يافته و خوب نگهداري شده بر اساس ويژگي هاي شغلي و عوامل انساني به کار گرفته نشوند، تمام کوشش هاي مديران منابع انساني و سازمان ها بيهود بوده و تمام دلسوزيها نقش بر آب خواهد شد.
با توجه به اينكه به نظر مي رسد رابطه تنگاتنگي بين بهره وري و بهره گيري از يافته هاي روان شناسي در فرآيند تجزيه و تحليل شغل، انتخاب علمي كاركنان، آموزش، ارزشيابي مشاغل، رهبري و ارزيابي عملكرد علمي كاركنان وجود داشته باشد نياز به انجام پژوهش در زمينه بررسي ميزان توجه مديران نسبت به بهره گيري از يافته هاي روانشناسي صنعتي و سازماني ضروري به نظر مي رسد.

اهميت و ضرورت پژوهش :
وقتي يک سازمان در جهت دستيابي به سطوح بالاي بهره وري حرکت مي کند، بدين معناست که تلاش براي رسيدن به مرحله بالندگي را آغاز کرده است. در چنين سازماني، رهبري و مديريت اثربخش، مي باشد و تعداد مديران شايسته در آن، زياد است. يکي از مهمترين عوامل مؤثر در استفاده بهينه از نيروي انساني سازمان، رهبري اثربخش مي باشد و مديران کارآمد و لايق مي دانند چگونه منابع انساني سازمان را در جهت افزايش بهره وري شغلي، ترغيب کنند. جو سازماني مناسب و رضايت از کار باعث مي شود کارکنان سازمان با ميل و رغبت بيشتري بر سر کار خود حاضر شوند. از طرف ديگر مهمترين عامل يا مانع براي دستيابي به بهره وري بهينه سازمان، منابع انساني ناکارآمد است. نياز سازمان هابه حضور يا وجود افراد کارآمد ، پرتلاش ، سالم ، علاقمند و خلاق همانند نياز آدمي به تغذيه مناسب است. در سازمان هاي موفق، کليه کارکنان براي ايفاي نقش خود انگيخته شده اند و به کار خود علاقمند هستند. تاريخ گواه آن است که ظهور و سقوط ملت ها با افزايش و کاهش بهره وري ملي همبستگي دارد. تا زماني که بهره وري سازمان ها در حد بالا و بهينه نباشد ، بهره وري ملي نياز پايين خواهد بود (ساعتچي، 1384).
آنگلوس ماديسون8 معتقد است ظهور و سقوط ملتها را مي توان در سرتاسر تاريخ جهان و با مشخص ساختن سطح بهره وري آنان، تعيين و پيش بيني كرد. ملتهايي كه در طول تاريخ سقوط كرده اند، گويي كه به بيماري تصلب شرائين مبتلا شده باشند، اقتصادشان پير و فرتوت شده، سرعت انطباق يافتن آنان با تحولات جهاني و نيز پاسخدهي آنان نسبت به تحولات و نوآوري هاي ملل و اقوام ديگر كاهش پيدا كرده است. و بالاخره در مسيري قرار گرفته اند كه از ابعاد مختلف اقتصادي و فرهنگي از رونق افتاده اند (ساعتچي، 1386).
با توجه به اهميت افزايش بهره وري در سازمان ها، محقق در تحقيق حاضر به دنبال يافتن ميزان بهره گيري مديران دانشگاههاي آزاد اسلامي منطقه 1 از مفاهيم و فنون به کارگيري اثربخش منابع انساني در واحدهاي محل کارخود مي باشد. بديهي است در صورتي که ضرورت به کارگيري يافته هاي روانشناسي صنعتي و سازماني به مديران دانشگاهي آموزش داده شود سطح بهره وري در دانشگاهها بالارفته، دانشجوياني که در دانشگاهها مشغول به تحصيل مي باشند الگوگيري بهينه مديريت صحيح علمي را بدست آورده، هنگام اشتغال به کار در ديگر ادارات و ارگان هاي کشور شيوه هاي صحيح مديريت علمي را اعمال نموده، ميزان بهره وري در دانشگاه بالا خواهد رفت. به بيان ديگر مي توان گفت فرهنگ سازي صحيح در رابطه با مديريت علمي و استفاده صحيح از يافته هاي روانشناسي صنعتي و سازماني بايستي از دانشگاهها شروع شده و به ديگر ارگان ها و ادارات منتقل يابد. پزوهش حاضر گامي است در جهت تحقق اهداف مذکور که منجر به بسط اطلاعات در اين زمينه شده، يافته هاي آن نهايتاً مي تواند در بهره وري سازما
ني و ملي اثرگذار باشد.
اهداف پژوهش :
هدف اصلي اين پژوهش انجام يک تحقيق توصيفي-زمينه يابي جهت بررسي ميزان بهره گيري مديران دانشگاه هاي آزاد اسلامي منطقه 1 از مفاهيم و فنون اثربخش منابع انساني در محل کار خود
مي باشد.
دومين هدف اين پژوهش، پاسخدهي به اين سوال است که: آيا بين ويژگي هاي جمعيت شناختي مديران و ميزان بهره گيري آنان از فنون و مفاهيم بکارگيري اثربخش منابع انساني تفاوت معناداري وجود دارد؟
سومين هدف اين پژوهش، پاسخدهي به اين سوال است که: بهره گيري مديران دانشگاه هاي آزاد اسلامي منطقه 1 از روانشناسان صنعتي و سازماني در محل کار خود به چه ميزان است؟

سئوالهاي پژوهش
1. بهره گيري مديران دانشگاه هاي آزاد اسلامي منطقه 1 از مفاهيم و فنون به کارگيري اثربخش منابع انساني در محل کار خود به چه ميزان است؟
2. آيا بين ويژگيهاي جمعيت شناختي مديران و ميزان بهره گيري آنان از مفاهيم و فنون به کارگيري اثربخش اثربخش منابع انساني تفاوت معناداري وجود دارد؟
3. بهره گيري مديران دانشگاه هاي آزاد اسلامي منطقه 1 از روانشناسان صنعتي و سازماني در محل کار خود به چه ميزان است؟
تعريف نظري و عملي متغيرها
الف- تعريف نظري بکارگيري مفاهيم و فنون اثربخش منابع انساني:
مدل نظامدار انتخاب و بکارگيري اثربخش منابع انساني در سازمان (مناباماس): در شرايطي يک فکر يا انديشه آرماني از ديدگاه کاربردي داراي ارزش است و مي تواند به پيش بيني احتمال کاهش يا افزايش بهره وري فردي، شغلي و سازماني بپردازد که همه عوامل و موانع انساني موثر در بهره وري سازمان مشخص سازد؛ اين عوامل را طبقه بندي کند؛ و از همه مهمتر روابط متقابل هر يک از اين عوامل را با يکديگر و نيز جايگاه هر عامل در مدلي که به اين منظور طراحي شده است، نشان دهد. مناباماس داراي ويژگي هاي فوق مي باشد، و شامل يک سري عوامل درون سازماني و برون سازماني موثر بر بهره وري سازمان است.
عوامل موثر بر بهره وري متعددند. بعضي از اين عوامل عبارتند از: سرمايه، روش هاي انجام دادن کار، ماشين آلات، فن آوري، ساختمان هاي مناسب، … و از همه مهمتر، ” منابع انساني فرهيخته و کارآمد”. بنابراين مناباماس در رابطه با ابعاد انساني بهره وري در سازمانها، طراحي و ارائه شده است. بر اساس نظريه چند عاملي بهره وري، اساسي ترين عوامل موثر در بهره وري يک سازمان همان “عوامل درون سازماني هستند” و کيفيت و ماهيت اين عوامل نيز تعيين کننده ديگر عوامل انساني موثر، در بهره وري مي باشد.
عوامل درون سازماني اصلي و موثر بر بهره وري سازمان عبارتند از: 1) تجزيه و تحليل شغل، 2) انتخاب علمي کارکنان، 3) آموزش اثر بخش کارکنان، 4) ارزيابي علمي عملکرد شغلي کارکنان، 5) تعيين مشوق هاي مالي و ارزشيابي مشاغل، 6) هدايت و اثرگذاري (ساعتچي، 1386).
ب – تعريف نظري تجزيه و تحليل شغل:
مک کرميک9 (1917) چهار جنبه براي تجزيه و تحليل شغل قايل شده است که بر اساس آن هر نوع تجزيه و تحليل شغل مي تواند متفاوت باشد: 1- نوع توصيف کننده ها يا عناصري که براي توصيف مشاغل بکار گرفته مي شود. 2-صور کسب يا ارائه اطلاعات شغل، 3-منابع اطلاعات شغل، 4-روشهايي جمع آوري اطلاعات و داده ها (فرهنگي، 1387).
ساعتچي (1386) تجزيه و تحليل شغل را هر نوع فعاليت يا فرآيند جمع آوري، منظم کردن و ارزيابي اطلاعات مربوط به کار و کارکنان سازمان مي نامد.
ج- تعريف نظري انتخا

منبع پایان نامه درمورد endothelial، N,، physiology.، K,

Supplementation on Platelet Count and Maximal Oxygen Consumption in Healthy Males: University of Akron; 2009.
80. Yoon B-K, Kravitz L, Robergs R. VO2max, protocol duration, and the VO2 plateau. Med Sci Sports Exerc. 2007;39(7):1186-92.
81. Astorino TA, Robergs RA, Ghiasvand F, Marks D, Burns S. Incidence of the oxygen plateau at VO2max during exercise testing to volitional fatigue. Methods. 2000;3(4).
82. Heil M, Eitenmüller I, Schmitz?Rixen T, Schaper W. Arteriogenesis versus angiogenesis: similarities and differences. Journal of cellular and molecular medicine. 2006;10(1):45-55.
83. Saunders CJ, Xenophontos SL, Cariolou MA, Anastassiades LC, Noakes TD, Collins M. The bradykinin ?2 receptor (BDKRB2) and endothelial nitric oxide synthase 3 (NOS3) genes and endurance performance during Ironman Triathlons. Human molecular genetics. 2006;15(6):979-87.
84. Guo C, Henley JM. Wrestling with stress: Roles of protein SUMOylation and deSUMOylation in cell stress response. IUBMB life. 2014.
85. Ravasi AA, Yadegari M, Chobine S. Comparison of two types of physical activity on response serum VEGF-A, non-athletic men. 2014;6(1):41-56. (Persian)
86. Nourshahi M, Hedayati M, Nemati J, Ranjbar K, Gholamali M. Effect of 8 weeks endurance training on serum vascular endothelial growth factor and endostatin in Wistar rats. koomesh. 2012;13(4):474-9.
87. Shekarchizadeh P, Khazaei M, Gharakhanlou R, Karimian J, Safarzadeh AR. The Effects of Resistance Training on Plasma Angiogenic Factors in Normal Rats. Journal of Isfahan Medical School. 2012;30(176):170-83. (Persian)
88. Maryam N, R F, M G. Effects of acute eccentric exercise on serum vascular endothelial growth factor and endostatin concentration in male wistar rats. Journal of Sport in Biomotor Sciences. 2012;5(3):86-94. (Persian)
89. Aghjan S, Maryam N, Milani R, , et al. Effects of L-arginine supplementation on the response of VEGF and endostatin hind limb muscles of aged rats to acute exhaustive activity. MSc Thesis Beheshti University. 2012. (Persian)
90. Ross MD, Wekesa AL, Phelan JP, Harrison M. Resistance exercise increases endothelial progenitor cells and angiogenic factors. Medicine and science in sports and exercise. 2014;46(1):16-23.
91. Hassan AF, Kamal MM. Effect of exercise training and anabolic androgenic steroids on hemodynamics, glycogen content, angiogenesis and apoptosis of cardiac muscle in adult male rats. International journal of health sciences. 2013;7(1):47.
92. Hoier B, Nordsborg N, Andersen S, Jensen L, Nybo L, Bangsbo J, et al. Pro-and anti-angiogenic factors in human skeletal muscle in response to acute exercise and training. The Journal of physiology. 2012;590(3):595-606.
93. El Nabi¹ WMH, Eman M. The Possible Physiological Role of Vascular Endothelial Growth Factor Receptor-1 (VEGFR-1) in Adrenaline-Induced Myocardial Infarction in Rats with and Without Exercise. Journal of American Science. 2012;8(3).
94. Jones WS, Duscha BD, Robbins JL, Duggan NN, Regensteiner JG, Kraus WE, et al. Alteration in angiogenic and anti-angiogenic forms of vascular endothelial growth factor-A in skeletal muscle of patients with intermittent claudication following exercise training. Vascular medicine. 2012;17(2):94-100.
95. Hussein HHSA, Mohammed YA, editors. ENDURANCE TRAINING ENHANCES CIRCULATING PLASMA VEGF AND b-FGF IN OPEN WATER SWIMMERS. JOURNAL OF PHYSIOLOGICAL SCIENCES; 2009: SPRINGER TOKYO 1-11-11 KUDAN-KITA, CHIYODA-KU, TOKYO, 102-0073, JAPAN.
96. Nourshahi M, Hedayati M, Ranjbar K. The correlation between resting serum leptin and serum angiogenic indices at rest and after submaximal exercise. Regulatory peptides. 2012;173(1):6-12.
97. Iversen N, Krustrup P, Rasmussen HN, Rasmussen UF, Saltin B, Pilegaard H. Mitochondrial biogenesis and angiogenesis in skeletal muscle of the elderly. Experimental gerontology. 2011;46(8):670-8.
98. Thorell D, Borjesson M, Larsson P, Ulfhammer E, Karlsson L, DuttaRoy S. Strenuous exercise increases late outgrowth endothelial cells in healthy subjects. European journal of applied physiology. 2009;107(4):481-8.
99. Brixius K, Schoenberger S, Ladage D, Knigge H, Falkowski G, Hellmich M, et al. Long-term endurance exercise decreases antiangiogenic endostatin signalling in overweight men aged 50-60 years. British journal of sports medicine. 2008;42(2):126-9.
100. Van Craenenbroeck EM, Vrints CJ, Haine SE, Vermeulen K, Goovaerts I, Van Tendeloo VF, et al. A maximal exercise bout increases the number of circulating CD34+/KDR+ endothelial progenitor cells in healthy subjects. Relation with lipid profile. Journal of applied physiology. 2008;104(4):1006-13.
101. Van Craenenbroeck EM, Hoymans VY, Beckers PJ, Possemiers NM, Wuyts K, Paelinck BP, et al. Exercise training improves function of circulating angiogenic cells in patients with chronic heart failure. Basic research in cardiology. 2010;105(5):665-76.
102. Hellsten Y, Rufener N, Nielsen JJ, H?ier B, Krustrup P, Bangsbo J. Passive leg movement enhances interstitial VEGF protein, endothelial cell proliferation, and eNOS mRNA content in human skeletal muscle. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. 2008;294(3):R975-R82.
103. Gavin TP, Ruster RS, Carrithers JA, Zwetsloot KA, Kraus RM, Evans CA, et al. No difference in the skeletal muscle angiogenic response to aerobic exercise training between young and aged men. The Journal of physiology. 2007;585(1):231-9.
104. Gustafsson T, Rundqvist H, Norrbom J, Rullman E, Jansson E, Sundberg CJ. The influence of physical training on the angiopoietin and VEGF-A systems in human skeletal muscle. Journal of Applied Physiology. 2007;103(3):1012-20.
105. Rullman E, Rundqvist H, W?gs?ter D, Fischer H, Eriksson P, Sundberg CJ, et al. A single bout of exercise activates matrix metalloproteinase in human skeletal muscle. Journal of applied physiology. 2007;102(6):2346-51.
106. Takano H, Morita T, Iida H, Asada K-i, Kato M, Uno K, et al. Hemodynamic and hormonal responses to a short-term low-intensity resistance exercise with the reduction of muscle blood flow. European journal of applied physiology. 2005;95(1):65-73.
107. Suzuki J. Microvascular angioadaptation after endurance training with L-arginine supplementation in rat heart and hindleg muscles. Experimental physiology. 2005;90(5):763-71.
108. Sunderland KL, Greer F, Morales J. VO2max and ventilatory threshold of trained cyclists are not affected by 28-day L-arginine supplementation. The Journal of Strength & Conditioning Research. 2011;25(3):833-7.
109. Camic CL, Housh TJ, Mielke M, Zuniga JM, Hendrix CR, Johnson GO, et al. The effects of 4 weeks of an arginine-based supplement on the gas exchange threshold and peak oxygen uptake. Applied Physiology, Nutrition, and Metabolism. 2010;35(3):286-93.
110. Maxwell AJ, Ho H-KV, Le CQ, Lin PS, Bernstein D, Cooke JP. L-arginine enhances aerobic exercise capacity in association with augmented nitric oxide production. Journal of Applied Physiology. 2001;90(3):933-8.
111. Ainsworth B. The compendium of physical activities. Research Digest. 2003;2:1-8.
112. Ranjbar K, Maryam N, hedayati M,. Effect of Gender and Physical Activity on Serum Vascular Endothelial Growth Factor at Rest And Response to Submaximal Exercise. International journal of Endocrinology and Metabolism. 2011;13(3):294-300. (Persian)
113. Gu J-W, Gadonski G, Wang J, Makey I, Adair TH. Exercise increases endostatin in circulation of healthy volunteers. BMC physiology. 2004;4(1):2.
114. Wood R, Sanderson B, Askew C, Walker P, Green S, Stewart I. Effect of training on the response of plasma vascular endothelial growth factor to exercise in patients with peripheral arterial disease. Clinical Science. 2006;111:401-9.
115. Lang K, Ratke J. Leptin and adiponectin: new players in the field of tumor cell and leukocyte migration. Cell Communication and Signaling. 2009;7(1):27.
116. Ribatti D, Conconi MT, Nussdorfer GG. Nonclassic endogenous novel regulators of angiogenesis. Pharmac
ological reviews. 2007;59(2):185-205.
117. Saunders TJ, Palombella A, McGuire KA, Janiszewski PM, Després J-P, Ross R. Acute exercise increases adiponectin levels in abdominally obese men. Journal of nutrition and metabolism. 2012;2012.
118. Sponder M, Dangl D, Kampf S, Fritzer-Szekeres M, Strametz-Juranek J. Exercise increases serum endostatin levels in female and male patients with diabetes and controls. Cardiovascular diabetology. 2014;13(1):6.
119. Campbell B, Roberts M, Kerksick C, Wilborn C, Marcello B, Taylor L, et al. Pharmacokinetics, safety, and effects on exercise performance of L-arginine ?-ketoglutarate in trained adult men. Nutrition. 2006;22(9):872-81.
120. NAGAYA N, UEMATSU M, OYA H, SATO N, SAKAMAKI F, KYOTANI S, et al. Short-term oral administration of L-arginine improves hemodynamics and exercise capacity in patients with precapillary pulmonary hypertension. American journal of respiratory and critical care medicine. 2001;163(4):887-91.
121. L C, T C, K HC. Effect of supplemental oral L-arginine on exercise capacity in patients with stable angina pectoris. AMJ Cardiol. 1997;93:2153-41.
122. Goret L, Tanguy S, Guiraud I, Dauzat M, Obert P. Acute administration of l-arginine restores nitric oxide-mediated relaxation in isolated pulmonary arteries from pulmonary hypertensive exercise trained rats. European Journal of Pharmacology. 2008;581(1-2):148-56.

منبع پایان نامه درمورد VEGF، growth، endothelial، H,

. 2005;26(1):33-65.
14. Li WW, Tsakayannis D, Li VW. Angiogenesis: a control point for normal and delayed wound healing. Contemp Surg. 2003;1:5-11.
15. Guo C, Henley JM. Wrestling with stress: roles of protein SUMOylation and deSUMOylation in cell stress response. IUBMB life. 2014;66(2):71-7.
16. Nemet D, Oh Y, Kim H-S, Hill M, Cooper DM. Effect of intense exercise on inflammatory cytokines and growth mediators in adolescent boys. Pediatrics. 2002;110(4):681-9.
17. Yeh ET. SUMOylation and De-SUMOylation: wrestling with life’s processes. Journal of Biological Chemistry. 2009;284(13):8223-7.
18. Ahmetov I, Khakimullina A, Popov D, Missina S, Vinogradova O, Rogozkin V. Polymorphism of the vascular endothelial growth factor gene (VEGF) and aerobic performance in athletes. Human Physiology. 2008;34(4):477-81.
19. Roy S, Khanna S, Sen CK. Redox regulation of the VEGF signaling path and tissue vascularization: Hydrogen peroxide, the common link between physical exercise and cutaneous wound healing. Free Radical Biology and Medicine. 2008;44(2):180-92.
20. Suzuki J. L-Arginine and L-Ornithine Supplementation Facilitates Angiogenesis and Causes Additional Effects on Exercise-induced Angiogenesis in Hind-leg Muscles. Advances in exercise and sports physiology. 2009;15(3):101-8.
21. Nourshahi M, chadorneshin HT, Ranjbar K. The stimulus of angiogenesis during exercise and physical
activity. Quarterly of the Horizon of Medical Sciences. 2013;18(5):286-96.
22. Mansoor JK, Morrissey BM, Walby WF, Yoneda KY, Juarez M, Kajekar R, et al. L-arginine supplementation enhances exhaled NO, breath condensate VEGF, and headache at 4342 m. High altitude medicine & biology. 2005;6(4):289-300.
23. Shibuya M. Differential roles of vascular endothelial growth factor receptor-1 and receptor-2 in angiogenesis. BMB Reports. 2006;39(5):469-78.
24. Nowroozzadeh MH, Sharifi M. Anti-vascular endothelial growth factor (Anti-VEGF) as a potential novel adjunct in the management of choroidal melanoma. Journal of Medical Hypotheses and Ideas (Formerly: Iranian Journal of Medical Hypotheses and Ideas). 2008;2.
25. Adams MR, McCredie R, Jessup W, Robinson J, Sullivan D, Celermajer DS. Oral L-arginine improves endothelium-dependent dilatation and reduces monocyte adhesion to endothelial cells in young men with coronary artery disease. Atherosclerosis. 1997;129(2):261-9.
26. Prior BM, Yang H, Terjung RL. What makes vessels grow with exercise training? Journal of Applied Physiology. 2004;97(3):1119-28.
27. Gustafsson T, Ameln H, Fischer H, Sundberg C, Timmons J, Jansson E. VEGF-A splice variants and related receptor expression in human skeletal muscle following submaximal exercise. Journal of Applied Physiology. 2005;98(6):2137-46.
28. Goumas G, Tentolouris C, Tousoulis D, Stefanadis C, Toutouzas P. Therapeutic modification of the L-arginine-eNOS pathway in cardiovascular diseases. Atherosclerosis. 2001;154(2):255-67.
29. McConell GK. Effects of L-arginine supplementation on exercise metabolism. Current Opinion in Clinical Nutrition & Metabolic Care. 2007;10(1):46-51.
30. Suzuki J. Influence of amino acid supplementation on capillary growth in the heart and skeletal muscles. The Journal of Physical Fitness and Sports Medicine. 2013;2(2):237-41.
31. ?lvares T, Meirelles C, Bhambhani Y, Paschoalin VF, Gomes PC. L-Arginine as a Potential Ergogenic Aidin Healthy Subjects. Sports Med. 2011;41(3):233-48.
32. Fiorito C, Balestrieri ML, Crimi E, Giovane A, Grimaldi V, Minucci PB, et al. Effect of l-arginine on circulating endothelial progenitor cells and VEGF after moderate physical training in mice. International journal of cardiology. 2008;126(3):421-3.
33. Suzuki J. L-arginine supplementation causes additional effects on exercise-induced angiogenesis and VEGF expression in the heart and hind-leg muscles of middle-aged rats. J Physiol Sci. 2006;56(1):39-44.
34. Lerman A, Burnett JC, Higano ST, McKinley LJ, Holmes DR. Long-term L-arginine supplementation improves small-vessel coronary endothelial function in humans. Circulation. 1998;97(21):2123-8.
35. Prior BM, Lloyd PG, Yang H, Terjung RL. Exercise-induced vascular remodeling. Exercise and sport sciences reviews. 2003;31(1):26-33.
36. Prior SJ. DNA Sequence Variation in the Promoter Region of the VEGF Gene: Impacts on VEGF Gene Expression and Maximal Oxygen Consumption. 2005.
37. Folkman J. Angiogenesis. Annual review of medicine. 2006;57:1-18.
38. Sia D, Alsinet C, Newell P, Villanueva A. VEGF Signaling in Cancer Treatment. Current Pharmaceutical Design. 2014;20(17):2834-42.
39. Beam W, Adams G. Exercise physiology laboratory manual: McGraw-Hill Higher Education; 2013.
40. Campbell BI, La Bounty PM, Roberts M. The ergogenic potential of arginine. J Int Soc Sports Nutr. 2004;1(2):35-8.
41. Breier G. Angiogenesis in Embryonic Development-A Review. Placenta. 2000;21:S11-S5.
42. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nature medicine. 1995;1(1):27-30.
43. Lloyd PG, Prior BM, Li H, Yang HT, Terjung RL. VEGF receptor antagonism blocks arteriogenesis, but only partially inhibits angiogenesis, in skeletal muscle of exercise-trained rats. American Journal of Physiology-Heart and Circulatory Physiology. 2005;288(2):H759-H68.
44. http://www.rndsystems.com/Pathway.aspx?p=18690&r=15436.
45. Chung HJ, Mahalingam M. Angiogenesis, vasculogenic mimicry and vascular invasion in cutaneous malignant melanoma – implications for therapeutic strategies and targeted therapies. Expert Review of Anticancer Therapy. 2014;14(5):621-39.
46. Mart?nez A. A new family of angiogenic factors. Cancer letters. 2006;236(2):157-63.
47. Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial growth factor (VEGF) and its receptors. The FASEB Journal. 1999;13(1):9-22.
48. Hoeben A, Landuyt B, Highley MS, Wildiers H, Van Oosterom AT, De Bruijn EA. Vascular endothelial growth factor and angiogenesis. Pharmacological reviews. 2004;56(4):549-80.
49. Hauk JM, Hosey RG. Nitric oxide therapy: fact or fiction? Current sports medicine reports. 2006;5(4):199.
50. B?ger RH, Ron ES. L-Arginine Improves Vascular Function by Overcoming the Deleterious Effects of ADMA, a Novel Cardiovascular Risk Factor. Alternative medicine review. 2005;10(1).
51. El Assar De La Fuente M, Angulo Frutos J, Vallejo Fern?n S, Peir? Vallejo C, S?nchez-Ferrer CF, Rodr?guez-Ma?as L. Mechanisms involved in the aging-induced vascular dysfunction. Frontiers in Physiology. 2012;3.
52. Tsai P-H, Tang T-K, Juang C-L, Chen K, Chi C-A, Hsu M-C. Effects of arginine supplementation on post-exercise metabolic responses. Chin J Physiol. 2009;52(3):136-42.
53. Alderton W, Cooper C, Knowles R. Nitric oxide synthases: structure, function and inhibition. Biochem J. 2001;357:593-615.
54. Bilusic M, Wong YN. Anti-angiogenesis in prostate cancer: knocked down but not out. Asian Journal of Andrology. 2014;16(3):372-7.
55. http://www.pdb.org/pdb/explore/explore.do?structureId=1KOE.
56. Heljasvaara R, Nyberg P, Luostarinen J, Parikka M, Heikkil? P, Rehn M, et al. Generation of biologically active endostatin fragments from human collagen XVIII by distinct matrix metalloproteases. Experimental cell research. 2005;307(2):292-304.
57. Sauter BV, Martinet O, Zhang W-J, Mandeli J, Woo SL. Adenovirus-mediated gene transfer of endostatin in vivo results in high level of transgene expression and inhibition of tumor growth and metastases. Proceedings of the National Academy of Sciences. 2000;97(9):4802-7.
58. Joki T, Machluf M, Atala A, Zhu J, Seyfried NT, Dunn IF, et al. Continuous release of endostatin from microencapsulated engineered cells for tumor therapy. Nature biotechnology. 2001;19(1):35-9.
59. Blezinger P, Wang J, Gondo M, Quezada A, Mehrens D, French M, et al. Systemic inhibition of tumor growth and tumor metastases by intramuscular administration of the endostatin gene. Nature biotechnology. 1999;17(4):343-8.
60. Sasaki T
, Fukai N, Mann K, G?hring W, Olsen BR, Timpl R. Structure, function and tissue forms of the C?terminal globular domain of collagen XVIII containing the angiogenesis inhibitor endostatin. The EMBO Journal. 1998;17(15):4249-56.
61. Digtyar A, Pozdnyakova N, Feldman N, Lutsenko S, Severin S. Endostatin: current concepts about its biological role and mechanisms of action. Biochemistry (Moscow). 2007;72(3):235-46.
62. Cao Y, Cao R, Veitonmaki N. Kringle structures and antiangiogenesis. Current Medicinal Chemistry-Anti-Cancer Agents. 2002;2(6):667-81.
63. Pestell RG, Li Z. Antisense to cyclin D1 inhibits VEGF-stimulated growth of vascular endothelial cells: implication of tumor vascularization. Clinical Cancer Research. 2006;12(15):4459-62.
64. Wernicke AG, Varma S, Greenwood EA, Christos PJ, Chao KSC, Liu H, et al. Prostate-specific membrane antigen expression in tumor-associated vasculature of breast cancers. Apmis. 2014;122(6):482-9.
65. Olsson A-K, Johansson I, ?kerud H, Einarsson B, Christofferson R, Sasaki T, et al. The minimal active domain of endostatin is a heparin-binding motif that mediates inhibition of tumor vascularization. Cancer research. 2004;64(24):9012-7.
66. Mott JD, Werb Z. Regulation of matrix biology by matrix metalloproteinases. Current opinion in cell biology. 2004;16(5):558-64.
67. Awata T, Inoue K, Kurihara S, Ohkubo T, Watanabe M, Inukai K, et al. A common polymorphism in the 5?-untranslated region of the VEGF gene is associated with diabetic retinopathy in type 2 diabetes. Diabetes. 2002;51(5):1635-9.
68. Howell W, Ali S, Rose-Zerilli M, Ye S. VEGF polymorphisms and severity of atherosclerosis. Journal of medical genetics. 2005;42(6):485-90.
69. Greenberger S, Boscolo E, Adini I, Mulliken JB, Bischoff J. Corticosteroid suppression of VEGF-A in infantile hemangioma-derived stem cells. New England Journal of Medicine. 2010;362(11):1005-13.
70. Simonetti O, Lucarini G, Goteri G, Zizzi A, Biagini G, Lo ML, et al. VEGF is likely a key factor in the link between inflammation and angiogenesis in psoriasis: results of an immunohistochemical study. International journal of immunopathology and pharmacology. 2005;19(4):751-60.
71. Paleolog EM, Young S, Stark AC, McCloskey RV, Feldmann M, Maini RN. Modulation of angiogenic vascular endothelial growth factor by tumor necrosis factor ? and interleukin?1 in rheumatoid arthritis. Arthritis & Rheumatism. 1998;41(7):1258-65.
72. Gealekman O, Burkart A, Nicoloro SM, Straubhaar J, Corvera S. Enhanced angiogenesis in obesity and in response to PPAR? activators through adipocyte VEGF and ANGPTL4 production. American Journal of Physiology-Endocrinology and Metabolism. 2008;295(5):E1056-E64.
73. Hoier B, Hellsten Y. Exercise?Induced Capillary Growth in Human Skeletal Muscle and the Dynamics of VEGF. Microcirculation. 2014;21(4):301-14.
74. Breen E, Tang K, Olfert M, Knapp A, Wagner P. Skeletal muscle capillarity during hypoxia: VEGF and its activation. High Altitude Medicine & Biology. 2008;9(2):158-66.
75. Laughlin M, Roseguini B. Mechanisms for exercise training-induced increases in skeletal muscle blood flow capacity: differences with interval sprint training versus aerobic endurance training. Journal of physiology and pharmacology: an official journal of the Polish Physiological Society. 2008;59(Suppl 7):71.
76. Richardson R, Wagner H, Mudaliar S, Henry R, Noyszewski E, Wagner P. Human VEGF gene expression in skeletal muscle: effect of acute normoxic and hypoxic exercise. American Journal of Physiology-Heart and Circulatory Physiology. 1999;277(6):H2247-H52.
77. Paniagua OA, Bryant MB, Panza JA. Role of Endothelial Nitric Oxide in Shear Stress-Induced Vasodilation of Human Microvasculature Diminished Activity in Hypertensive and Hypercholesterolemic Patients. Circulation. 2001;103(13):1752-8.
78. Dellamea BS, Leit?o CB, Friedman R, Canani LH. Nitric oxide system and diabetic nephropathy. Diabetology & metabolic syndrome. 2014;6(1):17.
79. Corbett EJ. Effects of Oral L-arginine

پایان نامه ارشد درباره endothelial، N,، physiology.، K,

Supplementation on Platelet Count and Maximal Oxygen Consumption in Healthy Males: University of Akron; 2009.
80. Yoon B-K, Kravitz L, Robergs R. VO2max, protocol duration, and the VO2 plateau. Med Sci Sports Exerc. 2007;39(7):1186-92.
81. Astorino TA, Robergs RA, Ghiasvand F, Marks D, Burns S. Incidence of the oxygen plateau at VO2max during exercise testing to volitional fatigue. Methods. 2000;3(4).
82. Heil M, Eitenmüller I, Schmitz?Rixen T, Schaper W. Arteriogenesis versus angiogenesis: similarities and differences. Journal of cellular and molecular medicine. 2006;10(1):45-55.
83. Saunders CJ, Xenophontos SL, Cariolou MA, Anastassiades LC, Noakes TD, Collins M. The bradykinin ?2 receptor (BDKRB2) and endothelial nitric oxide synthase 3 (NOS3) genes and endurance performance during Ironman Triathlons. Human molecular genetics. 2006;15(6):979-87.
84. Guo C, Henley JM. Wrestling with stress: Roles of protein SUMOylation and deSUMOylation in cell stress response. IUBMB life. 2014.
85. Ravasi AA, Yadegari M, Chobine S. Comparison of two types of physical activity on response serum VEGF-A, non-athletic men. 2014;6(1):41-56. (Persian)
86. Nourshahi M, Hedayati M, Nemati J, Ranjbar K, Gholamali M. Effect of 8 weeks endurance training on serum vascular endothelial growth factor and endostatin in Wistar rats. koomesh. 2012;13(4):474-9.
87. Shekarchizadeh P, Khazaei M, Gharakhanlou R, Karimian J, Safarzadeh AR. The Effects of Resistance Training on Plasma Angiogenic Factors in Normal Rats. Journal of Isfahan Medical School. 2012;30(176):170-83. (Persian)
88. Maryam N, R F, M G. Effects of acute eccentric exercise on serum vascular endothelial growth factor and endostatin concentration in male wistar rats. Journal of Sport in Biomotor Sciences. 2012;5(3):86-94. (Persian)
89. Aghjan S, Maryam N, Milani R, , et al. Effects of L-arginine supplementation on the response of VEGF and endostatin hind limb muscles of aged rats to acute exhaustive activity. MSc Thesis Beheshti University. 2012. (Persian)
90. Ross MD, Wekesa AL, Phelan JP, Harrison M. Resistance exercise increases endothelial progenitor cells and angiogenic factors. Medicine and science in sports and exercise. 2014;46(1):16-23.
91. Hassan AF, Kamal MM. Effect of exercise training and anabolic androgenic steroids on hemodynamics, glycogen content, angiogenesis and apoptosis of cardiac muscle in adult male rats. International journal of health sciences. 2013;7(1):47.
92. Hoier B, Nordsborg N, Andersen S, Jensen L, Nybo L, Bangsbo J, et al. Pro-and anti-angiogenic factors in human skeletal muscle in response to acute exercise and training. The Journal of physiology. 2012;590(3):595-606.
93. El Nabi¹ WMH, Eman M. The Possible Physiological Role of Vascular Endothelial Growth Factor Receptor-1 (VEGFR-1) in Adrenaline-Induced Myocardial Infarction in Rats with and Without Exercise. Journal of American Science. 2012;8(3).
94. Jones WS, Duscha BD, Robbins JL, Duggan NN, Regensteiner JG, Kraus WE, et al. Alteration in angiogenic and anti-angiogenic forms of vascular endothelial growth factor-A in skeletal muscle of patients with intermittent claudication following exercise training. Vascular medicine. 2012;17(2):94-100.
95. Hussein HHSA, Mohammed YA, editors. ENDURANCE TRAINING ENHANCES CIRCULATING PLASMA VEGF AND b-FGF IN OPEN WATER SWIMMERS. JOURNAL OF PHYSIOLOGICAL SCIENCES; 2009: SPRINGER TOKYO 1-11-11 KUDAN-KITA, CHIYODA-KU, TOKYO, 102-0073, JAPAN.
96. Nourshahi M, Hedayati M, Ranjbar K. The correlation between resting serum leptin and serum angiogenic indices at rest and after submaximal exercise. Regulatory peptides. 2012;173(1):6-12.
97. Iversen N, Krustrup P, Rasmussen HN, Rasmussen UF, Saltin B, Pilegaard H. Mitochondrial biogenesis and angiogenesis in skeletal muscle of the elderly. Experimental gerontology. 2011;46(8):670-8.
98. Thorell D, Borjesson M, Larsson P, Ulfhammer E, Karlsson L, DuttaRoy S. Strenuous exercise increases late outgrowth endothelial cells in healthy subjects. European journal of applied physiology. 2009;107(4):481-8.
99. Brixius K, Schoenberger S, Ladage D, Knigge H, Falkowski G, Hellmich M, et al. Long-term endurance exercise decreases antiangiogenic endostatin signalling in overweight men aged 50-60 years. British journal of sports medicine. 2008;42(2):126-9.
100. Van Craenenbroeck EM, Vrints CJ, Haine SE, Vermeulen K, Goovaerts I, Van Tendeloo VF, et al. A maximal exercise bout increases the number of circulating CD34+/KDR+ endothelial progenitor cells in healthy subjects. Relation with lipid profile. Journal of applied physiology. 2008;104(4):1006-13.
101. Van Craenenbroeck EM, Hoymans VY, Beckers PJ, Possemiers NM, Wuyts K, Paelinck BP, et al. Exercise training improves function of circulating angiogenic cells in patients with chronic heart failure. Basic research in cardiology. 2010;105(5):665-76.
102. Hellsten Y, Rufener N, Nielsen JJ, H?ier B, Krustrup P, Bangsbo J. Passive leg movement enhances interstitial VEGF protein, endothelial cell proliferation, and eNOS mRNA content in human skeletal muscle. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. 2008;294(3):R975-R82.
103. Gavin TP, Ruster RS, Carrithers JA, Zwetsloot KA, Kraus RM, Evans CA, et al. No difference in the skeletal muscle angiogenic response to aerobic exercise training between young and aged men. The Journal of physiology. 2007;585(1):231-9.
104. Gustafsson T, Rundqvist H, Norrbom J, Rullman E, Jansson E, Sundberg CJ. The influence of physical training on the angiopoietin and VEGF-A systems in human skeletal muscle. Journal of Applied Physiology. 2007;103(3):1012-20.
105. Rullman E, Rundqvist H, W?gs?ter D, Fischer H, Eriksson P, Sundberg CJ, et al. A single bout of exercise activates matrix metalloproteinase in human skeletal muscle. Journal of applied physiology. 2007;102(6):2346-51.
106. Takano H, Morita T, Iida H, Asada K-i, Kato M, Uno K, et al. Hemodynamic and hormonal responses to a short-term low-intensity resistance exercise with the reduction of muscle blood flow. European journal of applied physiology. 2005;95(1):65-73.
107. Suzuki J. Microvascular angioadaptation after endurance training with L-arginine supplementation in rat heart and hindleg muscles. Experimental physiology. 2005;90(5):763-71.
108. Sunderland KL, Greer F, Morales J. VO2max and ventilatory threshold of trained cyclists are not affected by 28-day L-arginine supplementation. The Journal of Strength & Conditioning Research. 2011;25(3):833-7.
109. Camic CL, Housh TJ, Mielke M, Zuniga JM, Hendrix CR, Johnson GO, et al. The effects of 4 weeks of an arginine-based supplement on the gas exchange threshold and peak oxygen uptake. Applied Physiology, Nutrition, and Metabolism. 2010;35(3):286-93.
110. Maxwell AJ, Ho H-KV, Le CQ, Lin PS, Bernstein D, Cooke JP. L-arginine enhances aerobic exercise capacity in association with augmented nitric oxide production. Journal of Applied Physiology. 2001;90(3):933-8.
111. Ainsworth B. The compendium of physical activities. Research Digest. 2003;2:1-8.
112. Ranjbar K, Maryam N, hedayati M,. Effect of Gender and Physical Activity on Serum Vascular Endothelial Growth Factor at Rest And Response to Submaximal Exercise. International journal of Endocrinology and Metabolism. 2011;13(3):294-300. (Persian)
113. Gu J-W, Gadonski G, Wang J, Makey I, Adair TH. Exercise increases endostatin in circulation of healthy volunteers. BMC physiology. 2004;4(1):2.
114. Wood R, Sanderson B, Askew C, Walker P, Green S, Stewart I. Effect of training on the response of plasma vascular endothelial growth factor to exercise in patients with peripheral arterial disease. Clinical Science. 2006;111:401-9.
115. Lang K, Ratke J. Leptin and adiponectin: new players in the field of tumor cell and leukocyte migration. Cell Communication and Signaling. 2009;7(1):27.
116. Ribatti D, Conconi MT, Nussdorfer GG. Nonclassic endogenous novel regulators of angiogenesis. Pharmac
ological reviews. 2007;59(2):185-205.
117. Saunders TJ, Palombella A, McGuire KA, Janiszewski PM, Després J-P, Ross R. Acute exercise increases adiponectin levels in abdominally obese men. Journal of nutrition and metabolism. 2012;2012.
118. Sponder M, Dangl D, Kampf S, Fritzer-Szekeres M, Strametz-Juranek J. Exercise increases serum endostatin levels in female and male patients with diabetes and controls. Cardiovascular diabetology. 2014;13(1):6.
119. Campbell B, Roberts M, Kerksick C, Wilborn C, Marcello B, Taylor L, et al. Pharmacokinetics, safety, and effects on exercise performance of L-arginine ?-ketoglutarate in trained adult men. Nutrition. 2006;22(9):872-81.
120. NAGAYA N, UEMATSU M, OYA H, SATO N, SAKAMAKI F, KYOTANI S, et al. Short-term oral administration of L-arginine improves hemodynamics and exercise capacity in patients with precapillary pulmonary hypertension. American journal of respiratory and critical care medicine. 2001;163(4):887-91.
121. L C, T C, K HC. Effect of supplemental oral L-arginine on exercise capacity in patients with stable angina pectoris. AMJ Cardiol. 1997;93:2153-41.
122. Goret L, Tanguy S, Guiraud I, Dauzat M, Obert P. Acute administration of l-arginine restores nitric oxide-mediated relaxation in isolated pulmonary arteries from pulmonary hypertensive exercise trained rats. European Journal of Pharmacology. 2008;581(1-2):148-56.

پایان نامه ارشد درباره VEGF، growth، endothelial، H,

. 2005;26(1):33-65.
14. Li WW, Tsakayannis D, Li VW. Angiogenesis: a control point for normal and delayed wound healing. Contemp Surg. 2003;1:5-11.
15. Guo C, Henley JM. Wrestling with stress: roles of protein SUMOylation and deSUMOylation in cell stress response. IUBMB life. 2014;66(2):71-7.
16. Nemet D, Oh Y, Kim H-S, Hill M, Cooper DM. Effect of intense exercise on inflammatory cytokines and growth mediators in adolescent boys. Pediatrics. 2002;110(4):681-9.
17. Yeh ET. SUMOylation and De-SUMOylation: wrestling with life’s processes. Journal of Biological Chemistry. 2009;284(13):8223-7.
18. Ahmetov I, Khakimullina A, Popov D, Missina S, Vinogradova O, Rogozkin V. Polymorphism of the vascular endothelial growth factor gene (VEGF) and aerobic performance in athletes. Human Physiology. 2008;34(4):477-81.
19. Roy S, Khanna S, Sen CK. Redox regulation of the VEGF signaling path and tissue vascularization: Hydrogen peroxide, the common link between physical exercise and cutaneous wound healing. Free Radical Biology and Medicine. 2008;44(2):180-92.
20. Suzuki J. L-Arginine and L-Ornithine Supplementation Facilitates Angiogenesis and Causes Additional Effects on Exercise-induced Angiogenesis in Hind-leg Muscles. Advances in exercise and sports physiology. 2009;15(3):101-8.
21. Nourshahi M, chadorneshin HT, Ranjbar K. The stimulus of angiogenesis during exercise and physical
activity. Quarterly of the Horizon of Medical Sciences. 2013;18(5):286-96.
22. Mansoor JK, Morrissey BM, Walby WF, Yoneda KY, Juarez M, Kajekar R, et al. L-arginine supplementation enhances exhaled NO, breath condensate VEGF, and headache at 4342 m. High altitude medicine & biology. 2005;6(4):289-300.
23. Shibuya M. Differential roles of vascular endothelial growth factor receptor-1 and receptor-2 in angiogenesis. BMB Reports. 2006;39(5):469-78.
24. Nowroozzadeh MH, Sharifi M. Anti-vascular endothelial growth factor (Anti-VEGF) as a potential novel adjunct in the management of choroidal melanoma. Journal of Medical Hypotheses and Ideas (Formerly: Iranian Journal of Medical Hypotheses and Ideas). 2008;2.
25. Adams MR, McCredie R, Jessup W, Robinson J, Sullivan D, Celermajer DS. Oral L-arginine improves endothelium-dependent dilatation and reduces monocyte adhesion to endothelial cells in young men with coronary artery disease. Atherosclerosis. 1997;129(2):261-9.
26. Prior BM, Yang H, Terjung RL. What makes vessels grow with exercise training? Journal of Applied Physiology. 2004;97(3):1119-28.
27. Gustafsson T, Ameln H, Fischer H, Sundberg C, Timmons J, Jansson E. VEGF-A splice variants and related receptor expression in human skeletal muscle following submaximal exercise. Journal of Applied Physiology. 2005;98(6):2137-46.
28. Goumas G, Tentolouris C, Tousoulis D, Stefanadis C, Toutouzas P. Therapeutic modification of the L-arginine-eNOS pathway in cardiovascular diseases. Atherosclerosis. 2001;154(2):255-67.
29. McConell GK. Effects of L-arginine supplementation on exercise metabolism. Current Opinion in Clinical Nutrition & Metabolic Care. 2007;10(1):46-51.
30. Suzuki J. Influence of amino acid supplementation on capillary growth in the heart and skeletal muscles. The Journal of Physical Fitness and Sports Medicine. 2013;2(2):237-41.
31. ?lvares T, Meirelles C, Bhambhani Y, Paschoalin VF, Gomes PC. L-Arginine as a Potential Ergogenic Aidin Healthy Subjects. Sports Med. 2011;41(3):233-48.
32. Fiorito C, Balestrieri ML, Crimi E, Giovane A, Grimaldi V, Minucci PB, et al. Effect of l-arginine on circulating endothelial progenitor cells and VEGF after moderate physical training in mice. International journal of cardiology. 2008;126(3):421-3.
33. Suzuki J. L-arginine supplementation causes additional effects on exercise-induced angiogenesis and VEGF expression in the heart and hind-leg muscles of middle-aged rats. J Physiol Sci. 2006;56(1):39-44.
34. Lerman A, Burnett JC, Higano ST, McKinley LJ, Holmes DR. Long-term L-arginine supplementation improves small-vessel coronary endothelial function in humans. Circulation. 1998;97(21):2123-8.
35. Prior BM, Lloyd PG, Yang H, Terjung RL. Exercise-induced vascular remodeling. Exercise and sport sciences reviews. 2003;31(1):26-33.
36. Prior SJ. DNA Sequence Variation in the Promoter Region of the VEGF Gene: Impacts on VEGF Gene Expression and Maximal Oxygen Consumption. 2005.
37. Folkman J. Angiogenesis. Annual review of medicine. 2006;57:1-18.
38. Sia D, Alsinet C, Newell P, Villanueva A. VEGF Signaling in Cancer Treatment. Current Pharmaceutical Design. 2014;20(17):2834-42.
39. Beam W, Adams G. Exercise physiology laboratory manual: McGraw-Hill Higher Education; 2013.
40. Campbell BI, La Bounty PM, Roberts M. The ergogenic potential of arginine. J Int Soc Sports Nutr. 2004;1(2):35-8.
41. Breier G. Angiogenesis in Embryonic Development-A Review. Placenta. 2000;21:S11-S5.
42. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nature medicine. 1995;1(1):27-30.
43. Lloyd PG, Prior BM, Li H, Yang HT, Terjung RL. VEGF receptor antagonism blocks arteriogenesis, but only partially inhibits angiogenesis, in skeletal muscle of exercise-trained rats. American Journal of Physiology-Heart and Circulatory Physiology. 2005;288(2):H759-H68.
44. http://www.rndsystems.com/Pathway.aspx?p=18690&r=15436.
45. Chung HJ, Mahalingam M. Angiogenesis, vasculogenic mimicry and vascular invasion in cutaneous malignant melanoma – implications for therapeutic strategies and targeted therapies. Expert Review of Anticancer Therapy. 2014;14(5):621-39.
46. Mart?nez A. A new family of angiogenic factors. Cancer letters. 2006;236(2):157-63.
47. Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial growth factor (VEGF) and its receptors. The FASEB Journal. 1999;13(1):9-22.
48. Hoeben A, Landuyt B, Highley MS, Wildiers H, Van Oosterom AT, De Bruijn EA. Vascular endothelial growth factor and angiogenesis. Pharmacological reviews. 2004;56(4):549-80.
49. Hauk JM, Hosey RG. Nitric oxide therapy: fact or fiction? Current sports medicine reports. 2006;5(4):199.
50. B?ger RH, Ron ES. L-Arginine Improves Vascular Function by Overcoming the Deleterious Effects of ADMA, a Novel Cardiovascular Risk Factor. Alternative medicine review. 2005;10(1).
51. El Assar De La Fuente M, Angulo Frutos J, Vallejo Fern?n S, Peir? Vallejo C, S?nchez-Ferrer CF, Rodr?guez-Ma?as L. Mechanisms involved in the aging-induced vascular dysfunction. Frontiers in Physiology. 2012;3.
52. Tsai P-H, Tang T-K, Juang C-L, Chen K, Chi C-A, Hsu M-C. Effects of arginine supplementation on post-exercise metabolic responses. Chin J Physiol. 2009;52(3):136-42.
53. Alderton W, Cooper C, Knowles R. Nitric oxide synthases: structure, function and inhibition. Biochem J. 2001;357:593-615.
54. Bilusic M, Wong YN. Anti-angiogenesis in prostate cancer: knocked down but not out. Asian Journal of Andrology. 2014;16(3):372-7.
55. http://www.pdb.org/pdb/explore/explore.do?structureId=1KOE.
56. Heljasvaara R, Nyberg P, Luostarinen J, Parikka M, Heikkil? P, Rehn M, et al. Generation of biologically active endostatin fragments from human collagen XVIII by distinct matrix metalloproteases. Experimental cell research. 2005;307(2):292-304.
57. Sauter BV, Martinet O, Zhang W-J, Mandeli J, Woo SL. Adenovirus-mediated gene transfer of endostatin in vivo results in high level of transgene expression and inhibition of tumor growth and metastases. Proceedings of the National Academy of Sciences. 2000;97(9):4802-7.
58. Joki T, Machluf M, Atala A, Zhu J, Seyfried NT, Dunn IF, et al. Continuous release of endostatin from microencapsulated engineered cells for tumor therapy. Nature biotechnology. 2001;19(1):35-9.
59. Blezinger P, Wang J, Gondo M, Quezada A, Mehrens D, French M, et al. Systemic inhibition of tumor growth and tumor metastases by intramuscular administration of the endostatin gene. Nature biotechnology. 1999;17(4):343-8.
60. Sasaki T
, Fukai N, Mann K, G?hring W, Olsen BR, Timpl R. Structure, function and tissue forms of the C?terminal globular domain of collagen XVIII containing the angiogenesis inhibitor endostatin. The EMBO Journal. 1998;17(15):4249-56.
61. Digtyar A, Pozdnyakova N, Feldman N, Lutsenko S, Severin S. Endostatin: current concepts about its biological role and mechanisms of action. Biochemistry (Moscow). 2007;72(3):235-46.
62. Cao Y, Cao R, Veitonmaki N. Kringle structures and antiangiogenesis. Current Medicinal Chemistry-Anti-Cancer Agents. 2002;2(6):667-81.
63. Pestell RG, Li Z. Antisense to cyclin D1 inhibits VEGF-stimulated growth of vascular endothelial cells: implication of tumor vascularization. Clinical Cancer Research. 2006;12(15):4459-62.
64. Wernicke AG, Varma S, Greenwood EA, Christos PJ, Chao KSC, Liu H, et al. Prostate-specific membrane antigen expression in tumor-associated vasculature of breast cancers. Apmis. 2014;122(6):482-9.
65. Olsson A-K, Johansson I, ?kerud H, Einarsson B, Christofferson R, Sasaki T, et al. The minimal active domain of endostatin is a heparin-binding motif that mediates inhibition of tumor vascularization. Cancer research. 2004;64(24):9012-7.
66. Mott JD, Werb Z. Regulation of matrix biology by matrix metalloproteinases. Current opinion in cell biology. 2004;16(5):558-64.
67. Awata T, Inoue K, Kurihara S, Ohkubo T, Watanabe M, Inukai K, et al. A common polymorphism in the 5?-untranslated region of the VEGF gene is associated with diabetic retinopathy in type 2 diabetes. Diabetes. 2002;51(5):1635-9.
68. Howell W, Ali S, Rose-Zerilli M, Ye S. VEGF polymorphisms and severity of atherosclerosis. Journal of medical genetics. 2005;42(6):485-90.
69. Greenberger S, Boscolo E, Adini I, Mulliken JB, Bischoff J. Corticosteroid suppression of VEGF-A in infantile hemangioma-derived stem cells. New England Journal of Medicine. 2010;362(11):1005-13.
70. Simonetti O, Lucarini G, Goteri G, Zizzi A, Biagini G, Lo ML, et al. VEGF is likely a key factor in the link between inflammation and angiogenesis in psoriasis: results of an immunohistochemical study. International journal of immunopathology and pharmacology. 2005;19(4):751-60.
71. Paleolog EM, Young S, Stark AC, McCloskey RV, Feldmann M, Maini RN. Modulation of angiogenic vascular endothelial growth factor by tumor necrosis factor ? and interleukin?1 in rheumatoid arthritis. Arthritis & Rheumatism. 1998;41(7):1258-65.
72. Gealekman O, Burkart A, Nicoloro SM, Straubhaar J, Corvera S. Enhanced angiogenesis in obesity and in response to PPAR? activators through adipocyte VEGF and ANGPTL4 production. American Journal of Physiology-Endocrinology and Metabolism. 2008;295(5):E1056-E64.
73. Hoier B, Hellsten Y. Exercise?Induced Capillary Growth in Human Skeletal Muscle and the Dynamics of VEGF. Microcirculation. 2014;21(4):301-14.
74. Breen E, Tang K, Olfert M, Knapp A, Wagner P. Skeletal muscle capillarity during hypoxia: VEGF and its activation. High Altitude Medicine & Biology. 2008;9(2):158-66.
75. Laughlin M, Roseguini B. Mechanisms for exercise training-induced increases in skeletal muscle blood flow capacity: differences with interval sprint training versus aerobic endurance training. Journal of physiology and pharmacology: an official journal of the Polish Physiological Society. 2008;59(Suppl 7):71.
76. Richardson R, Wagner H, Mudaliar S, Henry R, Noyszewski E, Wagner P. Human VEGF gene expression in skeletal muscle: effect of acute normoxic and hypoxic exercise. American Journal of Physiology-Heart and Circulatory Physiology. 1999;277(6):H2247-H52.
77. Paniagua OA, Bryant MB, Panza JA. Role of Endothelial Nitric Oxide in Shear Stress-Induced Vasodilation of Human Microvasculature Diminished Activity in Hypertensive and Hypercholesterolemic Patients. Circulation. 2001;103(13):1752-8.
78. Dellamea BS, Leit?o CB, Friedman R, Canani LH. Nitric oxide system and diabetic nephropathy. Diabetology & metabolic syndrome. 2014;6(1):17.
79. Corbett EJ. Effects of Oral L-arginine

مقاله رایگان درمورد دماي، تصوير، ايزوله، pcr

آن‌‌ها، اختلاف پتانسيل و شدت جريان‌هاي مختلف، منابع تغذيه ولتاژ تانك‌هاي مختلف الكتروفورز و تانك‌هاي مختلف الكتروفروز و هم چنين زمان‌هاي مختلف الكتروفورز مورد ارزيابي و بررسي قرار گرفتند، كه بهترين حالت با ژل آگاروز با غلظت 5/1 درصد حل شده در بافر TBE (5X) و بافر تانك TBE(1X)، اختلاف پتانسيل 80 ولت و به مدت 1 ساعت با دستگاه الكتروفورز شركتBio Rad حاصل آمد.

3-7-مواد مورد نياز براي انجام الکتروفورز
3-7-1-ژل آگارز
3-7-1-1-طرز تهية ژل آگاروز
درصد ژل مورد استفاده در اين تحقيق 5/1 درصد بوده با توجه به درصد ژل، ميزان پودر آگاروز را محاسبه نموده و پس از وزن كردن، پودر را بسته به نوع تانك (بزرگ و يا كوچك بودن) با ميزان مناسب از بافر TBE(1X) در داخل بشر مخلوط کرده و بر حسب نوع استفاده با درصد خاص 5/1 به ترتيب به ميزان 5/1گرم از پودر آگاروز با 100سي‌سي بافر(1X) TBE مخلوط گرديده و پس از مخلوط كردن پودر آگاروز در بافر TBE1 X، آن را در مايكروويو قرار داده و پس از شفاف شدن محلول و رسيدن دماي آن به 50-45 درجه سانتيگراد سپس شانه را در داخل آن قرار داده، بايد به دقت به داخل قالب ريخته ‌شود و تا سرد شدن كامل ژل صبر نموده تا زماني كه ژل حالت شيري رنگي را پيدا نمايد.

3-7-1-2-تهيه بافر الكتروفورز
* محلول EDTA
* Buric acid
* Tris base (TBE-5X)
محلول ذخيره 5 بار غليظ TBE(5X) به صورت زير تهيه و در زمان مصرف با آب مقطر رقيق شد. ابتدا 7/3 گرم EDTA را به همراه54 گرم از تريس بيس و 5/ 27 گرم از بوريك اسيد را وزن کرده و با آب مقطر به حجم 900 ميلي ليتر مي‌رسانيم. pH آن را روي 8 تنظيم نموده و به حجم 1000 ميلي ليتر رسانديم.
3-7-1-3-بافر سنگين کننده (10x Sample bading Buffer)
اين بافر سنگين کننده محلول است تا از درون چاهک ژل خارج نشود و از طرفي مي‌توان محل محصولات PCR را بوسيله رنگ بروم فنل بلو که در جلو حرکت مي‌کند را مشاهده کرد. 6 ميکروليتر از محصول PCR را با 5/1 ميکروليتر لودينگ بافر مخلوط کرده و به آرامي توسط سمپلر درون چاهک ژل تخليه گرديد.
ماركرمولکلي(DNA Lader )مورد استفاده
ماركر مورد استفاده در اين تحقيق 1000 DNA Lader bp ساخت شركت Viogene با فاصله 100 جفت باز از وزن 100 وزن 3000 جفت باز بود كه براي مشخص كردن طيف گسترده‌اي از باندها با اندازه‌هاي مختلف وزن مولكولي تعبيه شده است.
3-7-1-4-رنگ آميزي ژل:
رنگ مورد استفاده در اين تحقيق اتيديوم برومايد تهيه شده از شركت سيناژن بود. مقدار 30 ميكروليتر از رنگ با 300 سي‌سي آب مقطر دو بار تقطير مخلوط هم زده و ژل الكتروفورز به مدت 20 دقيقه در آن قرار داده تا مراحل رنگ آميزي انجام شود. رنگ اتيديوم برومايد سرطانزا بوده و از ريختن آن دركف آزمايشگاه و يا تماس با پوست جداً خودداري گردد. و سپس شستشوي ژل در آب مقطر و سرانجام در دستگاه Gel documentation عمل عكسبرداري از ژل و ذخيره اطلاعات انجام مي‌گرديد.
اين رنگ ساخته شده براي رنگ‌آميزي ژل‌هاي متعددي مي‌تواند مورد استفاده قرار گيرد و نيازي به تعويض آن در هر بار رنگ‌آميزي نمي‌باشد. همچنين قبل از قرار دادن ژل در تشتك رنگ‌آميزي به خوبي آن را به هم زده تا رنگ در تمامي قسمت‌ها پخش گردد و باندها به طور يكسان رنگ‌آميزي گردند. محل نگهداري رنگ در قسمتي تاريك و دور از نور آفتاب مي‌باشد. از ريختن آب گرم بر روي رنگ بعد از تعويض و ريختن آن در سينك ظرفشويي جهت جلوگيري از ايجاد بخارات سمي اكيداً خودداري شود. پس از رنگ‌آميزي مرحله شستشو در آب مقطر مي‌باشد به مدت 10 دقيقه ژل را از رنگ خارج و در آب مقطر جهت شستشو شدن قرار مي‌دهيم و پس از گذشتن زمان مذكور آن را بر روي صفحه دستگاه ژل داك قرار داده و از آن عكس گرفته مي‌شود. پس از انجام عكسبرداري و ذخيره كردن، ژل با دستكش درون پلاستيك قرار داده شده و در چاه مخصوص انداخته مي‌شود.
3-8-توالي‌يابي (sequencing)
پس از اتمام PCR، محصولات PCR در فريزر20- نگهداري گرديدند، سپس به همراه پرايمر به شركت پيشگام ارسال گرديد. محصولات PCR توسط اين شرکت براي توالي‌يابي به کشور کره ارسال گرديد. علاوه بر اين براي اطمينان بيشتر توالي ژن مورد نظر در سايت NCBI بلاست گرديد و صحت وجود ژن مورد نظر مورد تاييد قرار گرفت.
3-9-1- روش گرد آوري اطلاعات
ميداني: نمونه برداري از نمونه هاي ادرار مبتلا به عفونت ادراري
کتابخانه اي: انتخاب پرايمرهاي مناسب جهت هدف قرار دادن ژن هاي ويرولانس
آزمايشگاهي: جداسازي ايزوله ها و شناسايي ژن هاي ويرولانس ابزار گرد آوري اطلاعات
1. بانک هاي اطلاعاتي مانند اينترنت
2. نشريات معتبر جهت دستيابي به مقالات مرتبط با موضوع
3. جمع آوري نمونه هاي ادراري به منظور جداسازي اشريشيا کلي

3-9-2- روش تجزيه و تحليل اطلاعات
1. تکثير توالي هاي اختصاصي (ژن هاي ويرولانس) با استفاده از تکنيک PCR
2. تجزيه و تحليل باندها (اثر انگشت با استفاده از نرم افزار Image lab
3. بررسي آماري جهت تجزيه و تحليل داده ها : از نرم افزار SPSS نسخه 18 و همچنين جهت رسم
نمودارها و جداول از نرم افزار Microsoft Office Excel 2013 استفاده شد. مقايسه الگوهاي باندي DNA مربوط به ويرولوتايپ ها با رويت و محاسبه نحوه قرارگيري آن ها در ژل بر اساس وزن مولکولي آن ها ومقايسه با مارکر مولکولي و شمارش باندها جهت هر نمونه صورت گرفت. يک ماتريکس صفر و يک به منظور وجود يا عدم وجود باند تهيه و در پايگاه اينترنتي ثبت شد و ويرولوتايپ ها بر پايه مشاهده ي نحوه قرارگيري آن ها در ژل براساس وزن مولکولي آن ها و مقايسه با مار
کر مولکولي و شمارش باندها جهت هر نمونه انجام گرفت. شمارش سويه هاي واجد ژن ويرولانس و درصد گيري نسبت به کل نمونه ها مبناي درصد شيوع فاکتور ويرولانس مي باشد.
فصل چهارم
نتايج و بحث

4-1- فراواني بيماران بر اساس جنس
در مجموع از کل بيماران که مورد مطالعه قرار گرفتند 18 مورد، 18 درصد مذکر و 82 مورد، 82 درصد مونث بودند.(نمودار 4-1)

نمودار 4-1: فراواني بيماران بر اساس جنس

بيماران بر اساس سن در 4 گروه سني(Age) شامل: کودک کمتر از يک سال، نوجوان، جوان و مسن تقسيم بندي گرديدند. 4 مورد(4%) در گروه سني کمتر از يک سال، 3 مورد (3%) نوجوان، 63 مورد(63%) جوان و 30 مورد(30%) در گروه سني افراد مسن قرار داشتند.(نمودار4-2)

نمودار4-2: فراواني بيماران براساس سن(سال)

4-2-نتايج مربوط به فراواني فاکتورهاي حدت در اشرشيا کلي
بررسي هاي ويرولوتيپينگ ايزوله هاي اشرشيا کلي که توسط تکنيک PCR انجام گرديد نشان داد که 98% از ايزوله ها متعلق به ژن Pap، 95% از ايزوله ها متعلق به ژن aer ، 94% ايزوله ها متعلق به ژن Fim، 86% از ايزوله ها متعلق به ژن cnf ، 63% از ايزوله ها متعلق به ژن Afa ، 62% از ايزوله ها متعلق به ژن hlyA بودند. نمودار(4-3)

نمودار 4-3: نتايج مربوط به فراواني فاکتورهاي حدت در اشرشيا کلي

4-3- نتايج آزمون PCR براي شناسايي ژن آئروباکتين در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.

4-3-1-بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4-1 ) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 68 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 23 انتخاب گرديد).

تصوير4-1: دماهاي انتخاب شده براي انجام گراديانت دمايي جهت انتخاب دماي اتصال در يک واکنش pcr براي ژن aer، به ترتيب شماره از چاهک 1 الي 4 عبارتند از 69-68-67-66 درجه سانتي گراد و در سمت چپ مارکر مولکولي bp 1000 مي باشد.

4-3-1-1- انجام آزمون روي ساير ايزوله ها
پس از بهينه نمودن روش کار، آزمايش pcr بر روي ساير نمونه ها ي باليني صورت گرفت که با توجه به باندهاي بدست آمده، تصاوير همه باندها واضح بوده و طبق انتظار محصول pcr ما bp 602 تصوير (4-1-1-)(4-1-2-).

تصوير 4-1-1: نتايج pcr به منظور تکثير ژن aer در ساير ايزوله هاي باليني توسط مارکر مولکولي bp 1000 اعداد بالاي چاهکها مربوط به شماره ايزوله ها مي باشد.

تصوير شماره 4-1-2-: نتايج PCR بر روي برخي نمونه هاي باليني. رديف هاي 1 تا 4 نمونه هاي مثبت واجد ژن آئروباکتين و رديف هاي 5 و 6 به ترتيب نمونه کنترل منفي و نمونه فاقد ژن آئروباکتين. رديف MW مارکر مولکولي 1000 جفت بازي مي باشد.

4-3-2- نتايج آزمون PCR براي شناسايي ژن سايتوتوکسيک نکروزدهنده در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-3-2-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4- 2) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 57 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 5 انتخاب گرديد).

تصوير 4-2: دماهاي انتخاب شده براي انجام گراديانت دمايي جهت انتخاب دماي اتصال در يک واکنش pcr براي ژن cnf، به ترتيب شماره از چاهک 1 الي 7 عبارتند از 57-56-55-54-53-52- 51درجه سانتي گراد و در سمت چپ مارکر مولکولي bp 1000 مي باشد.
4-3-2-2- انجام آزمون روي ساير ايزوله ها
پس از بهينه نمودن روش کار، آزمايش pcr بر روي ساير نمونه ها ي باليني صورت گرفت که با توجه به باندهاي بدست آمده، تصاوير همه باندها واضح بوده و طبق انتظار محصول pcr ما bp 693 تصوير (4-2-1).

تصوير شماره 4-2-1: نتايج PCR بر روي برخي نمونه هاي باليني. رديف هاي C+ و C- به ترتيب کنترل مثبت و منفي، و رديفهاي 1و2،نمونه هاي منفي فاقد ژن و رديف 3 نمونه واجد ژن فاکتور نکروز دهنده سايتوتوکسيک. رديف MW مارکر مولکولي 1000 جفت بازي مي باشد.

4-3-3- نتايج آزمون PCR براي شناسايي ژن هموليزين در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-3-3-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4-3) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 62 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 5 انتخاب گرديد).

تصوير شماره4-3: دماي مناسب براي ژن hlya 62 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود نيازي به انجام گراديانت دمايي احساس نشد

4-4-4- نتايج آزمون PCR براي شناسايي ژن p-فيمبريه در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-4-4-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4- 4) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 63 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر ش
ماره 2 انتخاب گرديد).

تصوير شماره4-4: دماهاي انتخاب شده براي انجام گراديانت دمايي جهت انتخاب دماي اتصال در يک واکنش pcr براي ژن pap، به ترتيب شماره از چاهک 1 الي 7 عبارتند از 69-68-67-66-65-64-64درجه سانتي گراد و در سمت چپ مارکر مولکولي bp 1000 مي باشد.
4-4-4-2- انجام آزمون روي ساير ايزوله ها
پس از بهينه نمودن روش کار، آزمايش pcr بر روي ساير نمونه ها ي باليني صورت گرفت که با توجه به باندهاي بدست آمده، تصاوير همه باندها واضح بوده و طبق انتظار محصول pcr ما bp 328 تصوير (4-4-1-).

تصوير شماره4-4-1: نتايج PCR به منظور تکثير ژن Pap در برخي ايزوله هاي باليني توسط مارکر مولکولي bp 1000، اعداد بالاي چاهک ها مربوط به شماره ايزوله ها مي باشد.

4-5-5- نتايج آزمون PCR براي شناسايي ژن Afa در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-5-5-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4- 5) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 65 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 9 انتخاب گرديد).

تصوير 4-5: دماهاي انتخاب شده براي انجام گراديانت دمايي جهت انتخاب دماي اتصال در يک واکنش pcr براي ژن Afa، به ترتيب شماره از چاهک 1 الي 6 عبارتند از 69-68-67-66-65-64درجه سانتي گراد و در سمت چپ مارکر مولکولي bp 1000 مي باشد.

4-5-5-2- انجام آزمون روي ساير ايزوله ها
پس از بهينه نمودن روش کار، آزمايش pcr بر روي ساير نمونه ها ي باليني صورت گرفت که با توجه به باندهاي بدست آمده، تصاوير همه باندها واضح بوده و طبق انتظار محصول pcr ما bp 750 تصوير (4-5-1).

تصوير 4-5-1: نتايج PCR به منظور تکثير ژن Afa در برخي ايزوله هاي باليني توسط مارکر مولکولي bp 1000، اعداد بالاي چاهک ها مربوط به شماره ايزوله ها مي باشد.
4-6-6- نتايج آزمون PCR براي شناسايي ژن Fim در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-6-6-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4- 6) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 59 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 11 انتخاب گرديد).

تصوير 4-6: نتايج PCR به منظور تکثير ژنFim در برخي ايزوله هاي باليني توسط مارکر مولکولي bp 1000، اعداد بالاي چاهک ها مربوط به شماره ايزوله ها مي باشد.

مقاله رایگان درمورد دمايي، دقيقه، دماي، پرايمر

ن مي‌دهد. اين نسبت بايد بين 8/1 تا 2 باشد. اگر نسبت كوچك‌تر از 8/1 باشد، آلودگي DNA را با پروتئين يا فنل نشان مي‌دهد و نسبت بزرگتراز 2 به دليل وجود RNA در نمونه مي باشد.6

از تقسيم جذب نوري (OD) در طول موج 260 نانومتر به جذب نوري در طول موج 280 نانومتر ميزان خلوص نمونه ي DNA بدست آمد به اين صورت که با از دستگاه NANO DROP که متصل به کامپيوتر مي باشد ابتدا مقدار کمي در حد يک حباب آب مقطر ريخته و سپس Blank را زده تا دستگاه آماده اندازه گيري شود و سپس مقدار 1? از ژنوم را در جايگاه مورد نظر ريخته و سپس با زدن کليد Measure عمل محاسبه انجام مي گيرد و تصويري همراه با نمودار از ژنوم روي صفحه کامپيوتر حاصل مي شود (تصوير شماره3-1).

تصوير شماره 3-1 : کميت سنجي و غلظت سنجي DNA استخراج شده با استفاده از دستگاه NANO DROP
3-5-5- انجام آزمايشات مولکولي:
3-5-5-1- پرايمر ها:
براي اين منظور ابتدا توالي ژن هاي مورد نظر از پايگاه داده ها NCBI استخراج و سپس يک جفت پرايمر اختصاصي براي هر ژن با استفاده از نرم افزار آنلاين Primer3 با آدرس سايتي (http://frodo.wi.mit.edu/primer3) طراحي گرديد. در ادامه ميزان اختصاصي بودن پرايمرها با استفاده از Primer-blast با آدرس اينترنتي (http://www.ncbi.gov/tools/primer-blast )مورد ارزيابي قرار گرفت و به منظور آناليز جهت اطمينان از ساختارهاي ثانويه از نرم افزار oligo analyzer استفاده شد. طبق بررسي هاي به عمل آمده و مرور مطالعات توسط محققين جفت پرايمرهاي مناسب انتخاب و جهت تهيه به شرکت پيشگام سفارش داده شد. پرايمرها مهمترين عامل در موفقيت يا عدم موفقيت واکنشPCR هستند و معمولاً براساس توالي شناخته شده DNA الگو طراحي مي شوند. اگر پرايمرها به طور صحيح طراحي شده باشند واکنش PCR منجر به تکثير قطعه اي از DNA مي شود که با ناحيه هدف مولکول الگو مطابقت دارد و در صورتي که پرايمرها به طور صحيح طراحي نشوند واکنش با شکست روبه رو مي شود. در اين حالت هيچ قطعه اي تکثير نخواهد شد و يا اينکه قطعات اشتباهي تکثير خواهند شد(جدول 3-1).

جدول 3-1- مشخصات پرايمر هاي مورد استفاده
ژن هدف
? (3-5 ) سکانس پرايمر
تعداد نوکلئوتيد
وزن مولکولي
Cnf
F: TTATATAGTCGTCAAGATGGA

R: CACTAAGCTTTACAATATTGA

21
21
639
Pap
F: GAC GGC TGT ACT GCT GGG TGT GGC G

R: ATA TCC TTT CTG CAG GGA TGC AATA

25
25
328
HlyA
F: AACAAGGATAAGCACTGTTCTGGCT

R: ACCATATAAGCGGTCATTCCCGTCA

25
25
1177
Afa
F: GCTGGGCAGCAAACTGATAACTCTC

R: CATCAAGCTGTTTGTTCGTCCGCCG
25
25
750
Fim
F:GAGAAGAGGTTTGATTTAACTTATTG

R: AGAGCCGCTGTAGAACTGAGG
26
21
559
Aer
F: TACCGGATTGTCATATGCAGACCGT

R: AATATCTTCCTCCAGTCCGGAGAAG
25
25
602
3

3-5-5-2-رقيق سازي پرايمرها:
طبق دستور العمل شرکت سازنده براي رقيق سازي هر کدام از پرايمرها طبق فرمول زير عمل شد:
N1V1=N2V2 100(PM) × X=10 (PM) × 100(µL) ? 20(µL)
ابتدا پرايمرهاي موجود براي ژن هاي اختصاصي براي همه ژن هاي ويرولانس (که به صورت ليوفيليزه بودند) طبق دستورالعمل ارسال شده از طرف شرکت پيشگام تا غلظت PMOL/ µL100 با آب مقطر دوبار استريل رقيق شده و به عنوان استوک براي نگهداري طولاني مدت در فريزر20- درجه منتقل شد و محلول کاري با اضافه کردن µL 90 آب مقطر به µL 10 محلول استوک فراهم شد.
3-5-6- PCR
3-5-6-1-بهينه سازي اجزاء واکنش PCR
واکنش PCR در شرايط توصيه شده توسط ساير محققين در دستگاه مستر سايکلر اپندورف گراديانت طبق جدول زير انجام گرديد، اجزا و ترکيبات مورد استفاده براي واکنش PCR براي تمامي 6 ژن يکسان مي باشد (جدول شماره 3-2)

جدول 3-2: اجزاء و ترکيبات مورد استفاده براي واکنش PCR
اجزاي واکنش
غلظت
حجم(ميکروليتر)
مستر ميکسAmpliqon واجد Taq DNA polymerase به همراه بافر) dNTP (2X وکلريد منيزيم
X2
10
پرايمر فوروارد
10 پيکومول/ ميکروليتر
1
پرايمر ريورس
10 پيکومول/ ميکروليتر
1
ژنوم

1
آب مقطر آمپولي استريل

7
حجم نهايي

20

3-5-6-2-بهينه سازي تهيه Master Mix
در ابتدا بدون تهيه رقت از پرايمرها مستر ميکس تهيه شد و به طور تصادفي از ژنوم استخراج شده شماره 23، PCR انجام شد که پس از مراحل الکتروفورز و رنگ آميزي تجمع پرايمر محسوس بود. سپس با تهيه رقت از پرايمر طي چند مرحله، در نهايت رقت 20(pm) و حجم 2(µl) بدست آمد، که با انجام PCR جواب هاي قابل قبولي حاصل شد.

3-5-7- گراديانت دمايي جهت بدست آوردن دماي اتصال براي ژن aer
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 23 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از 69-68-67-66 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 68 درجه در ژن aer استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن aer در( جدول شماره 3-3) آمده است.

جدول 3-3: برنامه دمايي ترموسايکلر براي ژن aer
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°68
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3-5-7-1-گراديانت دمايي جهت بدست آوردن دماي اتصال براي ژن HlyA
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 5 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از 67-66-65-64-63-62-61-60-59-58 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 62 درجه در ژن HlyA استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن HlyA در( جدول شماره 3-4) آمده است.

جدول 3-4: برنامه دمايي ترموسايکلر براي ژن HlyA
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°62
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3-5-7-2- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Pap
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 2 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از72-71-70-69-68-67-66-65-64-63-62-61 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 63 درجه در ژن Pap استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن Pap در( جدول شماره 3-5)آمده است.

جدول 3-5 : برنامه دمايي ترموسايکلر براي ژن Pap
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30

1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°63
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3-5-7-3- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Cnf
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 5 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از59-58-57-56-55-54-53-52-51 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 57 درجه در ژن CNF استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن CNF در( جدول شماره 3-6)آمده است.

جدول 3-6: برنامه دمايي ترموسايکلر براي ژن CNF

مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30

1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°57
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3
3-5-7-4- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Afa
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 1 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از67-66-65-64-63-62-61-60-59-58-57 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 65 درجه در ژن Afa استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنشPCR براي ژن Afa در( جدول شماره 3-7)آمده است.

جدول 3-7: برنامه دمايي ترموسايکلر براي ژن ژن Afa
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°65
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3
3-5-7-5- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Fim
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 11 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از64 -63-62-61-60-59 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 59 درجه در ژن Fim استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن Fim در( جدول شماره 3-8)آمده است.

جدول 3-8: برنامه دمايي ترموسايکلر براي ژن Fim
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°59
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

. 3-6-مراحل انجام PCR
مرحله واسرشتي او
ليه1: در اين مرحله ابتدا با استفاده از حرارت دو رشته DNA از هم باز مي شوند. مطابق با جدول دماي دناتوراسيون C°95 و زمان مورد نياز معمولاً 5دقيقه است.
از اين مرحله به بعد وارد برنامه چرخه اي PCR مي شويم كه خود شامل سه مرحله است:
مرحله واسرشتي2: اين مرحله نيز مانند مرحله واسرشتي اوليه، اما با زماني كوتاهتر از آن انجام مي گيرد. دو رشته DNA بطور كامل در اين مرحله از هم جدا مي شوند. دماي مورد استفاده در اين مرحله 95درجه سلسيوس به مدت 30 ثانيه است.
مرحله اتصال3 :در اين مرحله با پايين آوردن دما و رساندن آن به حد مناسب تلاش مي شود تا پرايمرها بتوانند با رشته مكمل خود در DNA الگو جفت شوند.
مرحله طويل شدن4: دما بايد براي فعاليت آنزيم پليمراز مناسب باشد و در اين مرحله رشته مكمل رشته الگو ساخته خواهد شد و از آنجا كه رشته هاي ساخته شده جديد نيز مكمل آغازگرها هستند، اين چرخه حرارتي مي تواند چندين بار تكرار شود و به همين طريق ساخت و تكثير قطعات ادامه مي يابد. دماي اين مرحله 72 درجه سلسيوس مي باشد كه براي فعاليت آنزيم پليمراز مناسب است.7

3-6-1-بهينه‌سازي PCR
بهينه‌سازي يعني تعيين غلظت‌هاي مناسب مواد واكنشگر و دماي مناسب اتصال پرايمرها (Tm) جهت به دست آوردن محصول PCR مناسب براي اين منظور براي هر يك از پارامترها مثلTm آزمايشات مختلف انجام شد سپس با بررسي محصول و نوع پرايمرها و نيز شرايط واكنش، بهترين دما و سيكل انتخاب گرديد.
به منظور بدست آوردن دماي مناسب براي هر يک از پرايمرها جهت انجام واکنش PCR، نمونه کنترل مثبت را با يک جفت پرايمر گراديانت دمايي گذاشتيم و دماي مناسب هر يک گزارش شد.
عمل بهينه نمودن واكنش با تغييرات جزء به جزء و مرحله به مرحله در غلظت‌هاي DNA الگو، پرايمر، dNTPs، MgCI2، polymerase DNA Taq و بهترين دماي Annealing صورت گرفت تا اينكه شرايط بهينه جهت تكثير ژن‌هاي ويرولانس حاصل آمد.
3-6-2- بررسي محصول PCR
جهت آشكارسازي محصول PCR از روش متداول و سريع الكتروفورز ژل آگاروز و رنگ‌آميزي با اتيديوم برومايد براي آشكارسازي سكانس هدف تكثير يافته استفاده مي‌كنيم.
آگارز پلي ساكاريدي است كه در اثر حرارت در بافر مناسب خود به صورت‌ ژله‌اي با آرايش پليمري منظم و قطر منافذ مشخص در مي‌آيد. اين منافذ امكان عبور ماكرومولكول‌هاي DNA را در ژل آگاروز حين انجام الكتروفورز از قطب منفي (كاتد) به سمت قطب مثبت (آند) فراهم مي‌كند. غلظت بالاتر ژل آگاروز سبب ايجاد منافذ ريزتر مي‌شود كه قدرت تفكيك اندازه ‌DNA کوچکتري را فراهم مي‌كند.
با دانستن طول سكانس هدف، غلظت ژل آگاروز را براي بررسي محصول PCR خود تعيين كرده و ژل مناسب را تهيه نموديم.
حدود 6 ميكروليتر از نمونه‌ها با 5/1 ميكروليتر از بافر لود كننده با غلظت 6 شركت سيناژن، به خوبي مخلوط گرديده و در چاهك‌هاي ژل قرار داده مي‌شدند.
جهت بهينه نمودن الكتروفورز، اين عمل در حالات و شرايط مختلف آزمايش گرديد. بدين منظور انواع آگاروز از شركت‌هاي خارجي از جمله Gibco BRL, Bio Rad, Digma, Roche هم چنين انواع بافرها با غلظت‌ها و نسبت‌هاي مختلف مواد تشكيل دهنده

مقاله رایگان درمورد کلي، سويه، اشرشيا، شناسايي

مي شود که به سلول باکتري اجازه اتصال به سطح آنتروسيت را داده و موجب بروز حرکات تيپيک اتصال و محو شدن مي گردد(ون و همکاران، 2001)3.29

جدول شماره (1-1): ژن هاي ويرولانس در اشريشيا کلي و عملکرد ژن ها
ژن
پاتوتيپ
عملکرد
موقعيت ژنتيکي
آئروباکتين
اشرشيا کلي يوروپاتوژن
دفاعي
جزاير پاتوژنيسته
آلفا- هموليزين
اشرشيا کلي يوروپاتوژن
توکسين
پلاسميد ; ترانسپوزوم
سايتوتوکسيک نکروز دهنده
اشرشيا کلي يوروپاتوژن
توکسين
پلاسميد ; ترانسپوزوم
فيمبريه نوع I
اشرشيا کلي يوروپاتوژن
ادهسين
جزاير پاتوژنيسته
-P فيمبريه
اشرشيا کلي يوروپاتوژن
ادهسين
جزاير پاتوژنيسته
افمبريال- ادهسين
اشرشيا کلي يوروپاتوژن
ادهسين
جزاير پاتوژنيسته

1-9-1-3- مکانيسم بيماري زايي UPEC در ارتباط با افمبريال ادهسين (afa, foc, sfa, fim, pap,):
UPEC داراي فاکتورهاي اتصالي هستند به نام پيلي يا فيمبريه، که به آنها اجازه مي دهد تا به طور موفقيت آميزي عفونت را آغاز کنند (تيبا و همکاران، 2008).ادهسين ها آنتي ژن هاي فيمبريالي هستند که باکتري را قادر مي سازند تا به موکوس روده متصل شود (مولوي، 2002). از ادهسين هاي معمول موجود در اشرشيا کلي يوروپاتوژن مي توان به P فيميريا، فيمبريا نوع 1، S فيمبريا، FIC فيمبريا و خانواده ادهسين Dr و ادهسين هاي افمبريال مي باشد، نام برد. اين فيمبريه ها به ترتيب توسط ژنهاي(Afa, foc, sfa, Fim, Pap) کد مي شوند (ميازاکي و همکاران، 2002). در UPEC، فيمبريا نوع 1 مهمترين عامل حدت است. تعدادي از اعضاي خانواده انتروباکترياسه اين ژن را توليد مي کنند. فيمبريه نوع 1 به وسيله بيش از 90% سويه هاي اشرشيا کلي بيان مي شود. اين فيمبريه اتصال به گليکو پروتئين هاي ترشح شده و گليکو پروتئين هاي مانوزيله شده اي را که به سلول متصل شده اند وساطت مي کند. P-فيمبريه، ضمائم هتروپلي مريک سخت ميله مانندي هستند که از سطح سلول اشرشيا کلي بيرون زده اند و نشان داده شده است که در بيشتر از 70% اشرشيا کلي پيلونفريتوژن حضور دارد(چورمک، 2006). FIC فيمبريه به وسيله کلاستر ژن foc کد مي شود، يک فاکتور اتصالي غير هماگلوتينه کننده است که به وسيله تقريباً 14% از اشرشيا کلي ايجاد کننده عفونت دستگاه ادراري و 7% از سويه هاي مدفوعي اشرشيا کلي بيان مي شود. اين فيمبريه از نظر ژنتيکي مشابه S فيمبريه است اما از نظر اختصاصيت رسپتورهايشان با يکديگر متفاوتند(ناظمي و همکاران، 2010). S-فيمبريه به رسپتورهاي حاوي بخش هاي قندي اسيد سياليک متصل مي شود و در اشرشيا کلي ايجاد کننده سپتيس و پيلونفريت حضور دارد(مولوي، 2002). افمبريال ادهسين ها از نظر خصوصيات مورفولوژي و بيوشيميايي با ديگر ادهسين ها تفاوت دارند و توسط ژن afa کد مي گردند و نشان داده شده است که در ايجاد عفونت دستگاه ادراري داراي نقش مي باشند (تصوير شماره 1-2).

تصوير شماره (1-2): شکل شماتيک از نحوه اتصال باکتريE.coli به سطح سلول هاي اپيتليال سطحي بدن
1-9-1-4- مکانيسم بيماري زايي UPEC در ارتباط با سايتوتوکسيک نکروز دهنده(cnf):
سويه هاي بيماري زا قابليت توليد و نمود طيف وسيعي از عوامل حدت را دارند که بر اين اساس به پاتوتيپ هاي مختلفي از جمله انتروتوکسيژن(ETEC)، نکروتوکسيژنNTEC))، توليد کننده شيگا توکسين(STEC) و غيره تقسيم مي شوند. سويه هاي نکروتوکسيژن(NTEC) براي اولين بار دراسهال نوزادان گزارش شد(اولت و همکاران، 2007). در ميان محصولات، سيتوتوکسيک نکروز دهنده CNF1),(CNF2)) ممکن توکسين هاي ديگري نظير توکسين هاي تورم دهنده کشنده سلول (CDT)، هموليزين (hly)، P – فيمبريه (pap)، افمبريال ادهسين (afa)، Sفيمبريه (sfa)و …باشند. سويه هاي نکروتوکسيژن قادرند عامل سيتوتوکسيک نکروز دهنده (CNF) توليد کنند که موجب چند هسته اي شدن سلول ها در کشت سلول و نکروز پوست خرگوش مي گردد(الکس و همکاران، 2001).در سويه هاي اشرشيا کلي نکروتوکسيژن جدا شده از عفونت هاي مختلف انسان ودام ها سه نوع از توکسين هاي مذکور تحت عنوان عامل سيتوتوکسيک نکروز دهنده 1و2و3 CNF1, CNF2 ,CNF3)) شناسايي و گزارش شده است. عامل سيتوتوکسيک نکروز دهنده 2و1 پروتئين هاي مقاوم به حرارت بوده و از نظر وزن مولکولي تقريباً مشابه مي باشند و توالي نوکلئوتيدي ژن هاي کد کننده آنها 7/85 درصد مشابهت با يکديگر را نشان مي دهند(بلنکو وهمکاران،1993; بلنکو و همکاران، 1998). سويه هاي نکروتوکسيژن( NTEC1 و NTEC2 ) که به ترتيب عوامل سيتوتوکسيک نکروز دهنده 1و2 را توليد مي کنند از نظر ژنتيکي و ساختار آنتي ژني به يکديگر شباهت داشته و متعلق به گروه هاي سرومي يا سروتيپ هاي مختلف مي باشند(اسواد و همکاران، 1994; آماويزيت و همکاران، 2001). ژن کد کننده عامل سيتوتوکسيک نکروز دهنده 1 بر روي کروموزوم باکتري قرار داشته و معمولاً با ژن هاي کد کننده هموليزين و فيمبريه هاي P و S همراه است. سويه هاي نکروتوکسيژن 1 تاکنون از موارد عفونت هاي گوارشي نشخوارکنندگان، خوک، سگ و همچنين از عفونت هاي خارج گوارشي (نظير عفونت هاي ادراري) انسان جدا شده است(توت و همکاران، 2001; ون و همکاران، 2001). ژن کد کننده عامل سيتوتوکسيک نکروز دهنده 2 بر روي پلاسميدي به نام Vir قرار دارد و ممکن است با اپران هاي کد کننده عوامل فيمبريه اي F17 و يا غير فيمبريه اي Afa8 همراه باشد اما سويه هاي نکروتوکسيژن 2 عمدتاً از نشخوارکنندگان با علائم عفونت گوارشي يا سپتي سمي جدا مي گردد. عامل سيتوتوکسيک نکروز دهنده 3 که به تازگي در جدايه هاي اشرشيا ک
لي از بره و بزغاله هاي سالم و بيمار شناسايي شده است داراي مشابهت هايي با عوامل 1و2 است(الکس و همکاران،2001)1. ژن کد کننده اين فاکتور بر خلاف ژن هاي عامل سيتوتوکسيک نکروز دهنده 1و2 با ژن هاي کد کننده انتيمين و انتروهموليزين همراه است. در سال هاي اخير توکسين هاي تورم دهنده کشنده سلول (CDTs) در سويه هاي مختلف اشرشيا کلي شناسايي شده است که شامل 4 واريانت مي باشد اين توکسين ها موجب توقف تقسيم سلولي در مرحله G2/M مي شوند. توکسين هاي تورم دهنده کشنده سلول نوع 1و2 (CDT-I,CDT-II) از نظر وابستگي با سويه هاي نکروتوکسيژن مورد توجه نيستند اما دسته ژن هاي کد کننده توکسين تورم دهنده سلول نوع 4 (CDT-IV) بر روي کروموزوم قرار دارند و به همين دليل همواره با عامل سيتوتوکسيک نکروز دهنده 1 همراه است(نعمتي و همکاران، 2012). در حالي که دسته ژن هاي کد کننده نوع 3 (CDT-III) بر روي پلاسميد Vir قرار داشته و به همراه عامل سيتوتوکسيک نکروز دهنده 2 شناسايي مي گردد. تاکنون حضور توکسين هاي تورم دهنده کشنده سلول در سويه هاي نکروتوکسيژن نوع 3 گزارش نشده است. به تازگي دسته پنجمي از توکسين هاي تورم دهنده کشنده سلول در سويه اي انتروپاتوژنيک جدا شده از دام ها شناسايي و گزارش شده است که با ژن شيگا توکسين همراه است(توچان و همکاران، 2009)2.30
شيوع ژن توليد کننده CNF در اشرشيا کلي مرتبط با عفونت ادراري به طور گسترده اي گزارش شده است. علاوه بر اين، شرايط ميزبان مانند سن بالا و زمينه هايي مانند انسداد مجاري ادراري، ديابت شيرين و ضعف مثانه به کلونيزاسيون باکتري کمک کرده و نقش مهمي در عفونت ادراري دارد(گالز و همکاران، 2002; يولرد، 2003). تحقيقات نشان مي دهد که شيوع فاکتورهاي ويرولانس در سويه هاي UPEC با پاتوژنيسته ادراري در ارتباط است، سويه هاي UPEC انواع مختلف توکسين ها مانند هموليزين و CNF1 را توليد مي کنند تا محيط داخل بدن ميزبان را براي ايجاد عفونت آماده کنند. معمولاً بيان اين دو توکسين در راستاي يکديگر و نزديک به هم هستند.
1-9-1-5- مکانيسم بيماري زايي UPEC در ارتباط با هموليزين(hlyA):
دو نوع هموليزين توسط اشرشيا کلي توليد مي شود : 1) نوع ترشحي 2) متصل به سلول
آنها گلبول هاي سرخ و سفيد را پاره کرده و ممکن است از عمل بيگانه خواري جلوگيري کند. سويه هاي بيماري زاي اشرشيا کلي حاوي يک آندوتوکسين بوده که اثرات آن شبيه به ساير آندوتوکسين ها مي باشد. همچنين اين باکتري ها توليد نوع III سيستم ترشحي مي کند تا بتواند مولکول هاي موثر را مستقيماً وارد سلول باکتري نمايد. اين سيستم همچنين مي تواند سويه هاي تهاجمي اشرشيا کلي را وارد سلول هاي روده اي نمايد. اتصال از طريق پيلي و فيمبريه و انتيمين صورت مي گيرد فاکتورهاي بيماري زايي که کمک به تهاجم باکتري و بيماري زايي آن مي کند شامل کپسول مي باشد (تصوير شماره 1-3)(تصوير شماره1-4).

تصوير شماره (1-3): شکل شماتيک از فاکتورهاي ويرولانس در اشرشيا کلي

تصوير شماره (1-4): مکانسيم بيماري زايي UPEC
1-10-تعاريف واژه ها :
اشريشيا کلي : اشريشيا کلي باسيل گرم منفي، متعلق به خانواده انتروباکترياسه، بدون اسپور و متحرک به وسيله تاژ هاي پيراموني است.
تکنيک PCR (واکنش زنجيره اي پليمراز) : اين تکنيک مجموعه اي از واکنش هاي بيوشيميايي است که در طي آن قطعه مشخصي از DNA به طور تصاعدي تکثير مي يابد، بدين ترتيب مقادير انبوهي از DNA هدف ايجاد مي گردد.
عفونت دستگاه ادراري (UTI) نوعي عفونت باکتريايي است که بر بخشي از دستگاه ادراري تأثير مي‌گذارد. هنگامي که عفونت دستگاه ادراري تحتاني را مبتلا مي‌کند سيستيت ساده (عفونت مثانه) ناميده مي‌شود و هنگامي که بر دستگاه ادراري فوقاني تأثير مي‌گذارد به آن پيلونفريت (عفونت کليه) گفته مي‌شود.
ويرولوتايپينگ: دسته بندي تيپ هاي باکتري بر اساس وجود يا عدم وجود ژن هاي ويرولانس و بررسي رابطه ي خويشاوندي آنها مي باشد.
سيستيت : نوعي عفونت باکتريايي است که بر بخشي از دستگاه ادراري تأثير مي‌گذارد. هنگامي که عفونت دستگاه ادراري تحتاني را مبتلا مي‌کند سيستيت ساده (عفونت مثانه) ناميده مي‌شود.
پيلونفريت : نوعي عفونت باکتريايي است که بر بخشي از دستگاه ادراري تأثير مي‌گذارد. هنگامي که بر دستگاه ادراري فوقاني تأثير مي‌گذارد به آن پيلونفريت (عفونت کليه) گفته مي‌شود.

فصل دوم
مروري بر تحقيقات انجام شده
2-1- بررسي تحقيق هاي انجام شده:
1. Versalovic et al (1991) روشهاي تعيين اثر انگشت ژنوم باکتريها را بر اساس تکثير عناصر تکراري با استفاده از PCR ارائه نمودند. بر اساس اين دستاورد، عناصر تکراري DNA که به منظور تعيين اثر انگشت مورد استفاده قرار مي گيرند بر 3 نوع مي باشند(ورسالويک و همکاران، 1991).
2. Versalovic et al (1994)عناصر تکراري محافظت شده به طول 154 جفت باز به نام BOX، متشکل از 3 جزء boxA, boxB, boxC (ورسالويک و همکاران، 1994).
3. در سال 1999، PETER و همکاران طي يک پروژه تحقيقاتي، يک پروتوکل Multiplex PCR به منظور شناسايي همزمان شيگا توکسين 1 و 2 (stx1 , stx2)، اينتيمين (eaeA) و همولايزين (EHEC hlyA) ارائه نمودند. اين محققين با استفاده از اين روش اقدام به شناسايي سريع سويه هاي E.coli بيماريزا در انواع نمونه هاي محيطي و کلينيکي نمودند(پيتر و همکاران،1999).
4. در سال 1999، Sharma و همکاران و در سال 2006، Heijnen و همکاران توانستند با استفاده از غني سازي اوليه و متعاقباً شناسايي ژنهاي ويرولانس با استفاده از تکنيک real-time PCR، با سرعت و ويژگي بالا اقدام به شناسايي ان
واع سويه هاي انتروپاتوژن E.coli در نمونه هاي نمايند(چريف و همکاران، 2003).

5. در سال 2000، PASS و همکاران اقدام به پاتوتايپينگ و شناسايي 11 ژن ويرولانس E.coli اعم از LTI, LTIIa,، LTIIb، STI، STII، VT1، VT2,، VT2e, ، eaeA، Eagg و Einv پرداختند. اين محققين اعلام نمودند که مي توان با استناد به اين تکنيک، کليه سويه هاي انتروپاتوژن E.coli را از يکديگر تفکيک نمود (کمپبل و همکاران، 2001).
6. در سال 2000، در آمريکا مطالعه اي روي نمونه خون بيماران دچار اوروسپسيس نشان داد که traT يک ژن شايع در بيماران داراي نقص ايمني و افراد با سيستم ايمني کامل است(آندري و همکاران، 2008).
7. در سال 2001، Campbell و همکاران پروتوکل شناسايي سويه پاتوژن E.coli O157:H7 را در نمونه ها به صورت Multiplex PCR ارائه نمودند. اين محقيقن پروتکل پيشنهادي خود را که بر اساس شناسايي ژنهاي ويرولانس و ساختاري بود بسيار حساس و با ويژگي بالا معرفي کردند (توني و همکاران، 2006).
8. در سال 2003، Fode و همکاران وCebula و همکاران اقدام به شناسايي مستقيم سويه هاي پاتوژن (بالاخص انتروهموراژن) E.coli از نمونه هاي ادراري و نيز بررسي بيماريزايي آنها در بيماران پرداختند. به ادعاي اين محققين، روش ارائه شده مي تواند حساسيت و کارايي قابل قبولي در شناسايي مستقيم E.coli داشته باشد(فود و همکاران، 2003).
9. در سال 2006، Toni و همکاران با انجام چندين پروتوکل PCR (به صورت تک و مالتي پلکس)، 58 ژن ويرولانس E.coli را در نمونه هاي کلينيکي مورد شناسايي و ارزيابي قرار دادند. مطابق نتايج حاصل از اين تحقيق، راه انتقال سويه هاي پاتوژن E.coli به تعدادي از اين بيماران آلوده به عفونت هاي ادراري بوده است (توني و همکاران، 2006).
10. در سال 2007، Bekal و همکاران و در سال 2009، Bruant و همکاران با استفاده از تکنيک ريزآرايه اقدام به شناسايي ژنهاي ويرولانس پاتوتايپ هاي انتروپاتوژن E.coli نمودند (بکال و همکاران، 2007; برانت و همکاران، 2009).
11. در سال 2007،Lan و همکاران که در دانشگاه ميشيگان انجام شد، مشخص گرديد که فيمبريه نوع I به مقدار زيادي در طول عفونت دستگاه ادراري بيان مي گردد که اين بيان مي تواند منجر به کاهش حرکت در اين باکتري گردد و اين موضوع به عنوان يک عامل مهم در عفونت، به ويژه در 24 ساعت از زمان کلونيزاسيون در مثانه، تلقي مي گردد(لن و همکاران، 2009).

12. در سال2010،Pina و همکاران، توانستند با طراحي يک مالتي پلکس PCR، عامل عفوني موجود در نمونه هاي ادراري را شناسايي نمايند. حسب نتايج اين محققين مشخص شد که عامل عفوني E.coli سويه O157:H7 بوده است. ژنهايي که در اين تحقيق مورد شناسايي قرار گرفتند عبارت بودند از stx1، stx2، wzyO157 و . eae.
13. در سال 2011، Oliviera و همکاران در برزيل توانستند با طراحي يک مالتي پلکس PCR، عامل عفوني موجود در نمونه هاي ادراري را شناسايي نمايند(بلنکو و همکاران، 2003).
14. در سال 2012،Kudinha و همکاران در استراليا با روش multiplex