منبع پایان نامه درمورد endothelial، N,، physiology.، K,

Supplementation on Platelet Count and Maximal Oxygen Consumption in Healthy Males: University of Akron; 2009.
80. Yoon B-K, Kravitz L, Robergs R. VO2max, protocol duration, and the VO2 plateau. Med Sci Sports Exerc. 2007;39(7):1186-92.
81. Astorino TA, Robergs RA, Ghiasvand F, Marks D, Burns S. Incidence of the oxygen plateau at VO2max during exercise testing to volitional fatigue. Methods. 2000;3(4).
82. Heil M, Eitenmüller I, Schmitz?Rixen T, Schaper W. Arteriogenesis versus angiogenesis: similarities and differences. Journal of cellular and molecular medicine. 2006;10(1):45-55.
83. Saunders CJ, Xenophontos SL, Cariolou MA, Anastassiades LC, Noakes TD, Collins M. The bradykinin ?2 receptor (BDKRB2) and endothelial nitric oxide synthase 3 (NOS3) genes and endurance performance during Ironman Triathlons. Human molecular genetics. 2006;15(6):979-87.
84. Guo C, Henley JM. Wrestling with stress: Roles of protein SUMOylation and deSUMOylation in cell stress response. IUBMB life. 2014.
85. Ravasi AA, Yadegari M, Chobine S. Comparison of two types of physical activity on response serum VEGF-A, non-athletic men. 2014;6(1):41-56. (Persian)
86. Nourshahi M, Hedayati M, Nemati J, Ranjbar K, Gholamali M. Effect of 8 weeks endurance training on serum vascular endothelial growth factor and endostatin in Wistar rats. koomesh. 2012;13(4):474-9.
87. Shekarchizadeh P, Khazaei M, Gharakhanlou R, Karimian J, Safarzadeh AR. The Effects of Resistance Training on Plasma Angiogenic Factors in Normal Rats. Journal of Isfahan Medical School. 2012;30(176):170-83. (Persian)
88. Maryam N, R F, M G. Effects of acute eccentric exercise on serum vascular endothelial growth factor and endostatin concentration in male wistar rats. Journal of Sport in Biomotor Sciences. 2012;5(3):86-94. (Persian)
89. Aghjan S, Maryam N, Milani R, , et al. Effects of L-arginine supplementation on the response of VEGF and endostatin hind limb muscles of aged rats to acute exhaustive activity. MSc Thesis Beheshti University. 2012. (Persian)
90. Ross MD, Wekesa AL, Phelan JP, Harrison M. Resistance exercise increases endothelial progenitor cells and angiogenic factors. Medicine and science in sports and exercise. 2014;46(1):16-23.
91. Hassan AF, Kamal MM. Effect of exercise training and anabolic androgenic steroids on hemodynamics, glycogen content, angiogenesis and apoptosis of cardiac muscle in adult male rats. International journal of health sciences. 2013;7(1):47.
92. Hoier B, Nordsborg N, Andersen S, Jensen L, Nybo L, Bangsbo J, et al. Pro-and anti-angiogenic factors in human skeletal muscle in response to acute exercise and training. The Journal of physiology. 2012;590(3):595-606.
93. El Nabi¹ WMH, Eman M. The Possible Physiological Role of Vascular Endothelial Growth Factor Receptor-1 (VEGFR-1) in Adrenaline-Induced Myocardial Infarction in Rats with and Without Exercise. Journal of American Science. 2012;8(3).
94. Jones WS, Duscha BD, Robbins JL, Duggan NN, Regensteiner JG, Kraus WE, et al. Alteration in angiogenic and anti-angiogenic forms of vascular endothelial growth factor-A in skeletal muscle of patients with intermittent claudication following exercise training. Vascular medicine. 2012;17(2):94-100.
95. Hussein HHSA, Mohammed YA, editors. ENDURANCE TRAINING ENHANCES CIRCULATING PLASMA VEGF AND b-FGF IN OPEN WATER SWIMMERS. JOURNAL OF PHYSIOLOGICAL SCIENCES; 2009: SPRINGER TOKYO 1-11-11 KUDAN-KITA, CHIYODA-KU, TOKYO, 102-0073, JAPAN.
96. Nourshahi M, Hedayati M, Ranjbar K. The correlation between resting serum leptin and serum angiogenic indices at rest and after submaximal exercise. Regulatory peptides. 2012;173(1):6-12.
97. Iversen N, Krustrup P, Rasmussen HN, Rasmussen UF, Saltin B, Pilegaard H. Mitochondrial biogenesis and angiogenesis in skeletal muscle of the elderly. Experimental gerontology. 2011;46(8):670-8.
98. Thorell D, Borjesson M, Larsson P, Ulfhammer E, Karlsson L, DuttaRoy S. Strenuous exercise increases late outgrowth endothelial cells in healthy subjects. European journal of applied physiology. 2009;107(4):481-8.
99. Brixius K, Schoenberger S, Ladage D, Knigge H, Falkowski G, Hellmich M, et al. Long-term endurance exercise decreases antiangiogenic endostatin signalling in overweight men aged 50-60 years. British journal of sports medicine. 2008;42(2):126-9.
100. Van Craenenbroeck EM, Vrints CJ, Haine SE, Vermeulen K, Goovaerts I, Van Tendeloo VF, et al. A maximal exercise bout increases the number of circulating CD34+/KDR+ endothelial progenitor cells in healthy subjects. Relation with lipid profile. Journal of applied physiology. 2008;104(4):1006-13.
101. Van Craenenbroeck EM, Hoymans VY, Beckers PJ, Possemiers NM, Wuyts K, Paelinck BP, et al. Exercise training improves function of circulating angiogenic cells in patients with chronic heart failure. Basic research in cardiology. 2010;105(5):665-76.
102. Hellsten Y, Rufener N, Nielsen JJ, H?ier B, Krustrup P, Bangsbo J. Passive leg movement enhances interstitial VEGF protein, endothelial cell proliferation, and eNOS mRNA content in human skeletal muscle. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. 2008;294(3):R975-R82.
103. Gavin TP, Ruster RS, Carrithers JA, Zwetsloot KA, Kraus RM, Evans CA, et al. No difference in the skeletal muscle angiogenic response to aerobic exercise training between young and aged men. The Journal of physiology. 2007;585(1):231-9.
104. Gustafsson T, Rundqvist H, Norrbom J, Rullman E, Jansson E, Sundberg CJ. The influence of physical training on the angiopoietin and VEGF-A systems in human skeletal muscle. Journal of Applied Physiology. 2007;103(3):1012-20.
105. Rullman E, Rundqvist H, W?gs?ter D, Fischer H, Eriksson P, Sundberg CJ, et al. A single bout of exercise activates matrix metalloproteinase in human skeletal muscle. Journal of applied physiology. 2007;102(6):2346-51.
106. Takano H, Morita T, Iida H, Asada K-i, Kato M, Uno K, et al. Hemodynamic and hormonal responses to a short-term low-intensity resistance exercise with the reduction of muscle blood flow. European journal of applied physiology. 2005;95(1):65-73.
107. Suzuki J. Microvascular angioadaptation after endurance training with L-arginine supplementation in rat heart and hindleg muscles. Experimental physiology. 2005;90(5):763-71.
108. Sunderland KL, Greer F, Morales J. VO2max and ventilatory threshold of trained cyclists are not affected by 28-day L-arginine supplementation. The Journal of Strength & Conditioning Research. 2011;25(3):833-7.
109. Camic CL, Housh TJ, Mielke M, Zuniga JM, Hendrix CR, Johnson GO, et al. The effects of 4 weeks of an arginine-based supplement on the gas exchange threshold and peak oxygen uptake. Applied Physiology, Nutrition, and Metabolism. 2010;35(3):286-93.
110. Maxwell AJ, Ho H-KV, Le CQ, Lin PS, Bernstein D, Cooke JP. L-arginine enhances aerobic exercise capacity in association with augmented nitric oxide production. Journal of Applied Physiology. 2001;90(3):933-8.
111. Ainsworth B. The compendium of physical activities. Research Digest. 2003;2:1-8.
112. Ranjbar K, Maryam N, hedayati M,. Effect of Gender and Physical Activity on Serum Vascular Endothelial Growth Factor at Rest And Response to Submaximal Exercise. International journal of Endocrinology and Metabolism. 2011;13(3):294-300. (Persian)
113. Gu J-W, Gadonski G, Wang J, Makey I, Adair TH. Exercise increases endostatin in circulation of healthy volunteers. BMC physiology. 2004;4(1):2.
114. Wood R, Sanderson B, Askew C, Walker P, Green S, Stewart I. Effect of training on the response of plasma vascular endothelial growth factor to exercise in patients with peripheral arterial disease. Clinical Science. 2006;111:401-9.
115. Lang K, Ratke J. Leptin and adiponectin: new players in the field of tumor cell and leukocyte migration. Cell Communication and Signaling. 2009;7(1):27.
116. Ribatti D, Conconi MT, Nussdorfer GG. Nonclassic endogenous novel regulators of angiogenesis. Pharmac
ological reviews. 2007;59(2):185-205.
117. Saunders TJ, Palombella A, McGuire KA, Janiszewski PM, Després J-P, Ross R. Acute exercise increases adiponectin levels in abdominally obese men. Journal of nutrition and metabolism. 2012;2012.
118. Sponder M, Dangl D, Kampf S, Fritzer-Szekeres M, Strametz-Juranek J. Exercise increases serum endostatin levels in female and male patients with diabetes and controls. Cardiovascular diabetology. 2014;13(1):6.
119. Campbell B, Roberts M, Kerksick C, Wilborn C, Marcello B, Taylor L, et al. Pharmacokinetics, safety, and effects on exercise performance of L-arginine ?-ketoglutarate in trained adult men. Nutrition. 2006;22(9):872-81.
120. NAGAYA N, UEMATSU M, OYA H, SATO N, SAKAMAKI F, KYOTANI S, et al. Short-term oral administration of L-arginine improves hemodynamics and exercise capacity in patients with precapillary pulmonary hypertension. American journal of respiratory and critical care medicine. 2001;163(4):887-91.
121. L C, T C, K HC. Effect of supplemental oral L-arginine on exercise capacity in patients with stable angina pectoris. AMJ Cardiol. 1997;93:2153-41.
122. Goret L, Tanguy S, Guiraud I, Dauzat M, Obert P. Acute administration of l-arginine restores nitric oxide-mediated relaxation in isolated pulmonary arteries from pulmonary hypertensive exercise trained rats. European Journal of Pharmacology. 2008;581(1-2):148-56.

منبع پایان نامه درمورد VEGF، growth، endothelial، H,

. 2005;26(1):33-65.
14. Li WW, Tsakayannis D, Li VW. Angiogenesis: a control point for normal and delayed wound healing. Contemp Surg. 2003;1:5-11.
15. Guo C, Henley JM. Wrestling with stress: roles of protein SUMOylation and deSUMOylation in cell stress response. IUBMB life. 2014;66(2):71-7.
16. Nemet D, Oh Y, Kim H-S, Hill M, Cooper DM. Effect of intense exercise on inflammatory cytokines and growth mediators in adolescent boys. Pediatrics. 2002;110(4):681-9.
17. Yeh ET. SUMOylation and De-SUMOylation: wrestling with life’s processes. Journal of Biological Chemistry. 2009;284(13):8223-7.
18. Ahmetov I, Khakimullina A, Popov D, Missina S, Vinogradova O, Rogozkin V. Polymorphism of the vascular endothelial growth factor gene (VEGF) and aerobic performance in athletes. Human Physiology. 2008;34(4):477-81.
19. Roy S, Khanna S, Sen CK. Redox regulation of the VEGF signaling path and tissue vascularization: Hydrogen peroxide, the common link between physical exercise and cutaneous wound healing. Free Radical Biology and Medicine. 2008;44(2):180-92.
20. Suzuki J. L-Arginine and L-Ornithine Supplementation Facilitates Angiogenesis and Causes Additional Effects on Exercise-induced Angiogenesis in Hind-leg Muscles. Advances in exercise and sports physiology. 2009;15(3):101-8.
21. Nourshahi M, chadorneshin HT, Ranjbar K. The stimulus of angiogenesis during exercise and physical
activity. Quarterly of the Horizon of Medical Sciences. 2013;18(5):286-96.
22. Mansoor JK, Morrissey BM, Walby WF, Yoneda KY, Juarez M, Kajekar R, et al. L-arginine supplementation enhances exhaled NO, breath condensate VEGF, and headache at 4342 m. High altitude medicine & biology. 2005;6(4):289-300.
23. Shibuya M. Differential roles of vascular endothelial growth factor receptor-1 and receptor-2 in angiogenesis. BMB Reports. 2006;39(5):469-78.
24. Nowroozzadeh MH, Sharifi M. Anti-vascular endothelial growth factor (Anti-VEGF) as a potential novel adjunct in the management of choroidal melanoma. Journal of Medical Hypotheses and Ideas (Formerly: Iranian Journal of Medical Hypotheses and Ideas). 2008;2.
25. Adams MR, McCredie R, Jessup W, Robinson J, Sullivan D, Celermajer DS. Oral L-arginine improves endothelium-dependent dilatation and reduces monocyte adhesion to endothelial cells in young men with coronary artery disease. Atherosclerosis. 1997;129(2):261-9.
26. Prior BM, Yang H, Terjung RL. What makes vessels grow with exercise training? Journal of Applied Physiology. 2004;97(3):1119-28.
27. Gustafsson T, Ameln H, Fischer H, Sundberg C, Timmons J, Jansson E. VEGF-A splice variants and related receptor expression in human skeletal muscle following submaximal exercise. Journal of Applied Physiology. 2005;98(6):2137-46.
28. Goumas G, Tentolouris C, Tousoulis D, Stefanadis C, Toutouzas P. Therapeutic modification of the L-arginine-eNOS pathway in cardiovascular diseases. Atherosclerosis. 2001;154(2):255-67.
29. McConell GK. Effects of L-arginine supplementation on exercise metabolism. Current Opinion in Clinical Nutrition & Metabolic Care. 2007;10(1):46-51.
30. Suzuki J. Influence of amino acid supplementation on capillary growth in the heart and skeletal muscles. The Journal of Physical Fitness and Sports Medicine. 2013;2(2):237-41.
31. ?lvares T, Meirelles C, Bhambhani Y, Paschoalin VF, Gomes PC. L-Arginine as a Potential Ergogenic Aidin Healthy Subjects. Sports Med. 2011;41(3):233-48.
32. Fiorito C, Balestrieri ML, Crimi E, Giovane A, Grimaldi V, Minucci PB, et al. Effect of l-arginine on circulating endothelial progenitor cells and VEGF after moderate physical training in mice. International journal of cardiology. 2008;126(3):421-3.
33. Suzuki J. L-arginine supplementation causes additional effects on exercise-induced angiogenesis and VEGF expression in the heart and hind-leg muscles of middle-aged rats. J Physiol Sci. 2006;56(1):39-44.
34. Lerman A, Burnett JC, Higano ST, McKinley LJ, Holmes DR. Long-term L-arginine supplementation improves small-vessel coronary endothelial function in humans. Circulation. 1998;97(21):2123-8.
35. Prior BM, Lloyd PG, Yang H, Terjung RL. Exercise-induced vascular remodeling. Exercise and sport sciences reviews. 2003;31(1):26-33.
36. Prior SJ. DNA Sequence Variation in the Promoter Region of the VEGF Gene: Impacts on VEGF Gene Expression and Maximal Oxygen Consumption. 2005.
37. Folkman J. Angiogenesis. Annual review of medicine. 2006;57:1-18.
38. Sia D, Alsinet C, Newell P, Villanueva A. VEGF Signaling in Cancer Treatment. Current Pharmaceutical Design. 2014;20(17):2834-42.
39. Beam W, Adams G. Exercise physiology laboratory manual: McGraw-Hill Higher Education; 2013.
40. Campbell BI, La Bounty PM, Roberts M. The ergogenic potential of arginine. J Int Soc Sports Nutr. 2004;1(2):35-8.
41. Breier G. Angiogenesis in Embryonic Development-A Review. Placenta. 2000;21:S11-S5.
42. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nature medicine. 1995;1(1):27-30.
43. Lloyd PG, Prior BM, Li H, Yang HT, Terjung RL. VEGF receptor antagonism blocks arteriogenesis, but only partially inhibits angiogenesis, in skeletal muscle of exercise-trained rats. American Journal of Physiology-Heart and Circulatory Physiology. 2005;288(2):H759-H68.
44. http://www.rndsystems.com/Pathway.aspx?p=18690&r=15436.
45. Chung HJ, Mahalingam M. Angiogenesis, vasculogenic mimicry and vascular invasion in cutaneous malignant melanoma – implications for therapeutic strategies and targeted therapies. Expert Review of Anticancer Therapy. 2014;14(5):621-39.
46. Mart?nez A. A new family of angiogenic factors. Cancer letters. 2006;236(2):157-63.
47. Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial growth factor (VEGF) and its receptors. The FASEB Journal. 1999;13(1):9-22.
48. Hoeben A, Landuyt B, Highley MS, Wildiers H, Van Oosterom AT, De Bruijn EA. Vascular endothelial growth factor and angiogenesis. Pharmacological reviews. 2004;56(4):549-80.
49. Hauk JM, Hosey RG. Nitric oxide therapy: fact or fiction? Current sports medicine reports. 2006;5(4):199.
50. B?ger RH, Ron ES. L-Arginine Improves Vascular Function by Overcoming the Deleterious Effects of ADMA, a Novel Cardiovascular Risk Factor. Alternative medicine review. 2005;10(1).
51. El Assar De La Fuente M, Angulo Frutos J, Vallejo Fern?n S, Peir? Vallejo C, S?nchez-Ferrer CF, Rodr?guez-Ma?as L. Mechanisms involved in the aging-induced vascular dysfunction. Frontiers in Physiology. 2012;3.
52. Tsai P-H, Tang T-K, Juang C-L, Chen K, Chi C-A, Hsu M-C. Effects of arginine supplementation on post-exercise metabolic responses. Chin J Physiol. 2009;52(3):136-42.
53. Alderton W, Cooper C, Knowles R. Nitric oxide synthases: structure, function and inhibition. Biochem J. 2001;357:593-615.
54. Bilusic M, Wong YN. Anti-angiogenesis in prostate cancer: knocked down but not out. Asian Journal of Andrology. 2014;16(3):372-7.
55. http://www.pdb.org/pdb/explore/explore.do?structureId=1KOE.
56. Heljasvaara R, Nyberg P, Luostarinen J, Parikka M, Heikkil? P, Rehn M, et al. Generation of biologically active endostatin fragments from human collagen XVIII by distinct matrix metalloproteases. Experimental cell research. 2005;307(2):292-304.
57. Sauter BV, Martinet O, Zhang W-J, Mandeli J, Woo SL. Adenovirus-mediated gene transfer of endostatin in vivo results in high level of transgene expression and inhibition of tumor growth and metastases. Proceedings of the National Academy of Sciences. 2000;97(9):4802-7.
58. Joki T, Machluf M, Atala A, Zhu J, Seyfried NT, Dunn IF, et al. Continuous release of endostatin from microencapsulated engineered cells for tumor therapy. Nature biotechnology. 2001;19(1):35-9.
59. Blezinger P, Wang J, Gondo M, Quezada A, Mehrens D, French M, et al. Systemic inhibition of tumor growth and tumor metastases by intramuscular administration of the endostatin gene. Nature biotechnology. 1999;17(4):343-8.
60. Sasaki T
, Fukai N, Mann K, G?hring W, Olsen BR, Timpl R. Structure, function and tissue forms of the C?terminal globular domain of collagen XVIII containing the angiogenesis inhibitor endostatin. The EMBO Journal. 1998;17(15):4249-56.
61. Digtyar A, Pozdnyakova N, Feldman N, Lutsenko S, Severin S. Endostatin: current concepts about its biological role and mechanisms of action. Biochemistry (Moscow). 2007;72(3):235-46.
62. Cao Y, Cao R, Veitonmaki N. Kringle structures and antiangiogenesis. Current Medicinal Chemistry-Anti-Cancer Agents. 2002;2(6):667-81.
63. Pestell RG, Li Z. Antisense to cyclin D1 inhibits VEGF-stimulated growth of vascular endothelial cells: implication of tumor vascularization. Clinical Cancer Research. 2006;12(15):4459-62.
64. Wernicke AG, Varma S, Greenwood EA, Christos PJ, Chao KSC, Liu H, et al. Prostate-specific membrane antigen expression in tumor-associated vasculature of breast cancers. Apmis. 2014;122(6):482-9.
65. Olsson A-K, Johansson I, ?kerud H, Einarsson B, Christofferson R, Sasaki T, et al. The minimal active domain of endostatin is a heparin-binding motif that mediates inhibition of tumor vascularization. Cancer research. 2004;64(24):9012-7.
66. Mott JD, Werb Z. Regulation of matrix biology by matrix metalloproteinases. Current opinion in cell biology. 2004;16(5):558-64.
67. Awata T, Inoue K, Kurihara S, Ohkubo T, Watanabe M, Inukai K, et al. A common polymorphism in the 5?-untranslated region of the VEGF gene is associated with diabetic retinopathy in type 2 diabetes. Diabetes. 2002;51(5):1635-9.
68. Howell W, Ali S, Rose-Zerilli M, Ye S. VEGF polymorphisms and severity of atherosclerosis. Journal of medical genetics. 2005;42(6):485-90.
69. Greenberger S, Boscolo E, Adini I, Mulliken JB, Bischoff J. Corticosteroid suppression of VEGF-A in infantile hemangioma-derived stem cells. New England Journal of Medicine. 2010;362(11):1005-13.
70. Simonetti O, Lucarini G, Goteri G, Zizzi A, Biagini G, Lo ML, et al. VEGF is likely a key factor in the link between inflammation and angiogenesis in psoriasis: results of an immunohistochemical study. International journal of immunopathology and pharmacology. 2005;19(4):751-60.
71. Paleolog EM, Young S, Stark AC, McCloskey RV, Feldmann M, Maini RN. Modulation of angiogenic vascular endothelial growth factor by tumor necrosis factor ? and interleukin?1 in rheumatoid arthritis. Arthritis & Rheumatism. 1998;41(7):1258-65.
72. Gealekman O, Burkart A, Nicoloro SM, Straubhaar J, Corvera S. Enhanced angiogenesis in obesity and in response to PPAR? activators through adipocyte VEGF and ANGPTL4 production. American Journal of Physiology-Endocrinology and Metabolism. 2008;295(5):E1056-E64.
73. Hoier B, Hellsten Y. Exercise?Induced Capillary Growth in Human Skeletal Muscle and the Dynamics of VEGF. Microcirculation. 2014;21(4):301-14.
74. Breen E, Tang K, Olfert M, Knapp A, Wagner P. Skeletal muscle capillarity during hypoxia: VEGF and its activation. High Altitude Medicine & Biology. 2008;9(2):158-66.
75. Laughlin M, Roseguini B. Mechanisms for exercise training-induced increases in skeletal muscle blood flow capacity: differences with interval sprint training versus aerobic endurance training. Journal of physiology and pharmacology: an official journal of the Polish Physiological Society. 2008;59(Suppl 7):71.
76. Richardson R, Wagner H, Mudaliar S, Henry R, Noyszewski E, Wagner P. Human VEGF gene expression in skeletal muscle: effect of acute normoxic and hypoxic exercise. American Journal of Physiology-Heart and Circulatory Physiology. 1999;277(6):H2247-H52.
77. Paniagua OA, Bryant MB, Panza JA. Role of Endothelial Nitric Oxide in Shear Stress-Induced Vasodilation of Human Microvasculature Diminished Activity in Hypertensive and Hypercholesterolemic Patients. Circulation. 2001;103(13):1752-8.
78. Dellamea BS, Leit?o CB, Friedman R, Canani LH. Nitric oxide system and diabetic nephropathy. Diabetology & metabolic syndrome. 2014;6(1):17.
79. Corbett EJ. Effects of Oral L-arginine

پایان نامه ارشد درباره endothelial، N,، physiology.، K,

Supplementation on Platelet Count and Maximal Oxygen Consumption in Healthy Males: University of Akron; 2009.
80. Yoon B-K, Kravitz L, Robergs R. VO2max, protocol duration, and the VO2 plateau. Med Sci Sports Exerc. 2007;39(7):1186-92.
81. Astorino TA, Robergs RA, Ghiasvand F, Marks D, Burns S. Incidence of the oxygen plateau at VO2max during exercise testing to volitional fatigue. Methods. 2000;3(4).
82. Heil M, Eitenmüller I, Schmitz?Rixen T, Schaper W. Arteriogenesis versus angiogenesis: similarities and differences. Journal of cellular and molecular medicine. 2006;10(1):45-55.
83. Saunders CJ, Xenophontos SL, Cariolou MA, Anastassiades LC, Noakes TD, Collins M. The bradykinin ?2 receptor (BDKRB2) and endothelial nitric oxide synthase 3 (NOS3) genes and endurance performance during Ironman Triathlons. Human molecular genetics. 2006;15(6):979-87.
84. Guo C, Henley JM. Wrestling with stress: Roles of protein SUMOylation and deSUMOylation in cell stress response. IUBMB life. 2014.
85. Ravasi AA, Yadegari M, Chobine S. Comparison of two types of physical activity on response serum VEGF-A, non-athletic men. 2014;6(1):41-56. (Persian)
86. Nourshahi M, Hedayati M, Nemati J, Ranjbar K, Gholamali M. Effect of 8 weeks endurance training on serum vascular endothelial growth factor and endostatin in Wistar rats. koomesh. 2012;13(4):474-9.
87. Shekarchizadeh P, Khazaei M, Gharakhanlou R, Karimian J, Safarzadeh AR. The Effects of Resistance Training on Plasma Angiogenic Factors in Normal Rats. Journal of Isfahan Medical School. 2012;30(176):170-83. (Persian)
88. Maryam N, R F, M G. Effects of acute eccentric exercise on serum vascular endothelial growth factor and endostatin concentration in male wistar rats. Journal of Sport in Biomotor Sciences. 2012;5(3):86-94. (Persian)
89. Aghjan S, Maryam N, Milani R, , et al. Effects of L-arginine supplementation on the response of VEGF and endostatin hind limb muscles of aged rats to acute exhaustive activity. MSc Thesis Beheshti University. 2012. (Persian)
90. Ross MD, Wekesa AL, Phelan JP, Harrison M. Resistance exercise increases endothelial progenitor cells and angiogenic factors. Medicine and science in sports and exercise. 2014;46(1):16-23.
91. Hassan AF, Kamal MM. Effect of exercise training and anabolic androgenic steroids on hemodynamics, glycogen content, angiogenesis and apoptosis of cardiac muscle in adult male rats. International journal of health sciences. 2013;7(1):47.
92. Hoier B, Nordsborg N, Andersen S, Jensen L, Nybo L, Bangsbo J, et al. Pro-and anti-angiogenic factors in human skeletal muscle in response to acute exercise and training. The Journal of physiology. 2012;590(3):595-606.
93. El Nabi¹ WMH, Eman M. The Possible Physiological Role of Vascular Endothelial Growth Factor Receptor-1 (VEGFR-1) in Adrenaline-Induced Myocardial Infarction in Rats with and Without Exercise. Journal of American Science. 2012;8(3).
94. Jones WS, Duscha BD, Robbins JL, Duggan NN, Regensteiner JG, Kraus WE, et al. Alteration in angiogenic and anti-angiogenic forms of vascular endothelial growth factor-A in skeletal muscle of patients with intermittent claudication following exercise training. Vascular medicine. 2012;17(2):94-100.
95. Hussein HHSA, Mohammed YA, editors. ENDURANCE TRAINING ENHANCES CIRCULATING PLASMA VEGF AND b-FGF IN OPEN WATER SWIMMERS. JOURNAL OF PHYSIOLOGICAL SCIENCES; 2009: SPRINGER TOKYO 1-11-11 KUDAN-KITA, CHIYODA-KU, TOKYO, 102-0073, JAPAN.
96. Nourshahi M, Hedayati M, Ranjbar K. The correlation between resting serum leptin and serum angiogenic indices at rest and after submaximal exercise. Regulatory peptides. 2012;173(1):6-12.
97. Iversen N, Krustrup P, Rasmussen HN, Rasmussen UF, Saltin B, Pilegaard H. Mitochondrial biogenesis and angiogenesis in skeletal muscle of the elderly. Experimental gerontology. 2011;46(8):670-8.
98. Thorell D, Borjesson M, Larsson P, Ulfhammer E, Karlsson L, DuttaRoy S. Strenuous exercise increases late outgrowth endothelial cells in healthy subjects. European journal of applied physiology. 2009;107(4):481-8.
99. Brixius K, Schoenberger S, Ladage D, Knigge H, Falkowski G, Hellmich M, et al. Long-term endurance exercise decreases antiangiogenic endostatin signalling in overweight men aged 50-60 years. British journal of sports medicine. 2008;42(2):126-9.
100. Van Craenenbroeck EM, Vrints CJ, Haine SE, Vermeulen K, Goovaerts I, Van Tendeloo VF, et al. A maximal exercise bout increases the number of circulating CD34+/KDR+ endothelial progenitor cells in healthy subjects. Relation with lipid profile. Journal of applied physiology. 2008;104(4):1006-13.
101. Van Craenenbroeck EM, Hoymans VY, Beckers PJ, Possemiers NM, Wuyts K, Paelinck BP, et al. Exercise training improves function of circulating angiogenic cells in patients with chronic heart failure. Basic research in cardiology. 2010;105(5):665-76.
102. Hellsten Y, Rufener N, Nielsen JJ, H?ier B, Krustrup P, Bangsbo J. Passive leg movement enhances interstitial VEGF protein, endothelial cell proliferation, and eNOS mRNA content in human skeletal muscle. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. 2008;294(3):R975-R82.
103. Gavin TP, Ruster RS, Carrithers JA, Zwetsloot KA, Kraus RM, Evans CA, et al. No difference in the skeletal muscle angiogenic response to aerobic exercise training between young and aged men. The Journal of physiology. 2007;585(1):231-9.
104. Gustafsson T, Rundqvist H, Norrbom J, Rullman E, Jansson E, Sundberg CJ. The influence of physical training on the angiopoietin and VEGF-A systems in human skeletal muscle. Journal of Applied Physiology. 2007;103(3):1012-20.
105. Rullman E, Rundqvist H, W?gs?ter D, Fischer H, Eriksson P, Sundberg CJ, et al. A single bout of exercise activates matrix metalloproteinase in human skeletal muscle. Journal of applied physiology. 2007;102(6):2346-51.
106. Takano H, Morita T, Iida H, Asada K-i, Kato M, Uno K, et al. Hemodynamic and hormonal responses to a short-term low-intensity resistance exercise with the reduction of muscle blood flow. European journal of applied physiology. 2005;95(1):65-73.
107. Suzuki J. Microvascular angioadaptation after endurance training with L-arginine supplementation in rat heart and hindleg muscles. Experimental physiology. 2005;90(5):763-71.
108. Sunderland KL, Greer F, Morales J. VO2max and ventilatory threshold of trained cyclists are not affected by 28-day L-arginine supplementation. The Journal of Strength & Conditioning Research. 2011;25(3):833-7.
109. Camic CL, Housh TJ, Mielke M, Zuniga JM, Hendrix CR, Johnson GO, et al. The effects of 4 weeks of an arginine-based supplement on the gas exchange threshold and peak oxygen uptake. Applied Physiology, Nutrition, and Metabolism. 2010;35(3):286-93.
110. Maxwell AJ, Ho H-KV, Le CQ, Lin PS, Bernstein D, Cooke JP. L-arginine enhances aerobic exercise capacity in association with augmented nitric oxide production. Journal of Applied Physiology. 2001;90(3):933-8.
111. Ainsworth B. The compendium of physical activities. Research Digest. 2003;2:1-8.
112. Ranjbar K, Maryam N, hedayati M,. Effect of Gender and Physical Activity on Serum Vascular Endothelial Growth Factor at Rest And Response to Submaximal Exercise. International journal of Endocrinology and Metabolism. 2011;13(3):294-300. (Persian)
113. Gu J-W, Gadonski G, Wang J, Makey I, Adair TH. Exercise increases endostatin in circulation of healthy volunteers. BMC physiology. 2004;4(1):2.
114. Wood R, Sanderson B, Askew C, Walker P, Green S, Stewart I. Effect of training on the response of plasma vascular endothelial growth factor to exercise in patients with peripheral arterial disease. Clinical Science. 2006;111:401-9.
115. Lang K, Ratke J. Leptin and adiponectin: new players in the field of tumor cell and leukocyte migration. Cell Communication and Signaling. 2009;7(1):27.
116. Ribatti D, Conconi MT, Nussdorfer GG. Nonclassic endogenous novel regulators of angiogenesis. Pharmac
ological reviews. 2007;59(2):185-205.
117. Saunders TJ, Palombella A, McGuire KA, Janiszewski PM, Després J-P, Ross R. Acute exercise increases adiponectin levels in abdominally obese men. Journal of nutrition and metabolism. 2012;2012.
118. Sponder M, Dangl D, Kampf S, Fritzer-Szekeres M, Strametz-Juranek J. Exercise increases serum endostatin levels in female and male patients with diabetes and controls. Cardiovascular diabetology. 2014;13(1):6.
119. Campbell B, Roberts M, Kerksick C, Wilborn C, Marcello B, Taylor L, et al. Pharmacokinetics, safety, and effects on exercise performance of L-arginine ?-ketoglutarate in trained adult men. Nutrition. 2006;22(9):872-81.
120. NAGAYA N, UEMATSU M, OYA H, SATO N, SAKAMAKI F, KYOTANI S, et al. Short-term oral administration of L-arginine improves hemodynamics and exercise capacity in patients with precapillary pulmonary hypertension. American journal of respiratory and critical care medicine. 2001;163(4):887-91.
121. L C, T C, K HC. Effect of supplemental oral L-arginine on exercise capacity in patients with stable angina pectoris. AMJ Cardiol. 1997;93:2153-41.
122. Goret L, Tanguy S, Guiraud I, Dauzat M, Obert P. Acute administration of l-arginine restores nitric oxide-mediated relaxation in isolated pulmonary arteries from pulmonary hypertensive exercise trained rats. European Journal of Pharmacology. 2008;581(1-2):148-56.

پایان نامه ارشد درباره VEGF، growth، endothelial، H,

. 2005;26(1):33-65.
14. Li WW, Tsakayannis D, Li VW. Angiogenesis: a control point for normal and delayed wound healing. Contemp Surg. 2003;1:5-11.
15. Guo C, Henley JM. Wrestling with stress: roles of protein SUMOylation and deSUMOylation in cell stress response. IUBMB life. 2014;66(2):71-7.
16. Nemet D, Oh Y, Kim H-S, Hill M, Cooper DM. Effect of intense exercise on inflammatory cytokines and growth mediators in adolescent boys. Pediatrics. 2002;110(4):681-9.
17. Yeh ET. SUMOylation and De-SUMOylation: wrestling with life’s processes. Journal of Biological Chemistry. 2009;284(13):8223-7.
18. Ahmetov I, Khakimullina A, Popov D, Missina S, Vinogradova O, Rogozkin V. Polymorphism of the vascular endothelial growth factor gene (VEGF) and aerobic performance in athletes. Human Physiology. 2008;34(4):477-81.
19. Roy S, Khanna S, Sen CK. Redox regulation of the VEGF signaling path and tissue vascularization: Hydrogen peroxide, the common link between physical exercise and cutaneous wound healing. Free Radical Biology and Medicine. 2008;44(2):180-92.
20. Suzuki J. L-Arginine and L-Ornithine Supplementation Facilitates Angiogenesis and Causes Additional Effects on Exercise-induced Angiogenesis in Hind-leg Muscles. Advances in exercise and sports physiology. 2009;15(3):101-8.
21. Nourshahi M, chadorneshin HT, Ranjbar K. The stimulus of angiogenesis during exercise and physical
activity. Quarterly of the Horizon of Medical Sciences. 2013;18(5):286-96.
22. Mansoor JK, Morrissey BM, Walby WF, Yoneda KY, Juarez M, Kajekar R, et al. L-arginine supplementation enhances exhaled NO, breath condensate VEGF, and headache at 4342 m. High altitude medicine & biology. 2005;6(4):289-300.
23. Shibuya M. Differential roles of vascular endothelial growth factor receptor-1 and receptor-2 in angiogenesis. BMB Reports. 2006;39(5):469-78.
24. Nowroozzadeh MH, Sharifi M. Anti-vascular endothelial growth factor (Anti-VEGF) as a potential novel adjunct in the management of choroidal melanoma. Journal of Medical Hypotheses and Ideas (Formerly: Iranian Journal of Medical Hypotheses and Ideas). 2008;2.
25. Adams MR, McCredie R, Jessup W, Robinson J, Sullivan D, Celermajer DS. Oral L-arginine improves endothelium-dependent dilatation and reduces monocyte adhesion to endothelial cells in young men with coronary artery disease. Atherosclerosis. 1997;129(2):261-9.
26. Prior BM, Yang H, Terjung RL. What makes vessels grow with exercise training? Journal of Applied Physiology. 2004;97(3):1119-28.
27. Gustafsson T, Ameln H, Fischer H, Sundberg C, Timmons J, Jansson E. VEGF-A splice variants and related receptor expression in human skeletal muscle following submaximal exercise. Journal of Applied Physiology. 2005;98(6):2137-46.
28. Goumas G, Tentolouris C, Tousoulis D, Stefanadis C, Toutouzas P. Therapeutic modification of the L-arginine-eNOS pathway in cardiovascular diseases. Atherosclerosis. 2001;154(2):255-67.
29. McConell GK. Effects of L-arginine supplementation on exercise metabolism. Current Opinion in Clinical Nutrition & Metabolic Care. 2007;10(1):46-51.
30. Suzuki J. Influence of amino acid supplementation on capillary growth in the heart and skeletal muscles. The Journal of Physical Fitness and Sports Medicine. 2013;2(2):237-41.
31. ?lvares T, Meirelles C, Bhambhani Y, Paschoalin VF, Gomes PC. L-Arginine as a Potential Ergogenic Aidin Healthy Subjects. Sports Med. 2011;41(3):233-48.
32. Fiorito C, Balestrieri ML, Crimi E, Giovane A, Grimaldi V, Minucci PB, et al. Effect of l-arginine on circulating endothelial progenitor cells and VEGF after moderate physical training in mice. International journal of cardiology. 2008;126(3):421-3.
33. Suzuki J. L-arginine supplementation causes additional effects on exercise-induced angiogenesis and VEGF expression in the heart and hind-leg muscles of middle-aged rats. J Physiol Sci. 2006;56(1):39-44.
34. Lerman A, Burnett JC, Higano ST, McKinley LJ, Holmes DR. Long-term L-arginine supplementation improves small-vessel coronary endothelial function in humans. Circulation. 1998;97(21):2123-8.
35. Prior BM, Lloyd PG, Yang H, Terjung RL. Exercise-induced vascular remodeling. Exercise and sport sciences reviews. 2003;31(1):26-33.
36. Prior SJ. DNA Sequence Variation in the Promoter Region of the VEGF Gene: Impacts on VEGF Gene Expression and Maximal Oxygen Consumption. 2005.
37. Folkman J. Angiogenesis. Annual review of medicine. 2006;57:1-18.
38. Sia D, Alsinet C, Newell P, Villanueva A. VEGF Signaling in Cancer Treatment. Current Pharmaceutical Design. 2014;20(17):2834-42.
39. Beam W, Adams G. Exercise physiology laboratory manual: McGraw-Hill Higher Education; 2013.
40. Campbell BI, La Bounty PM, Roberts M. The ergogenic potential of arginine. J Int Soc Sports Nutr. 2004;1(2):35-8.
41. Breier G. Angiogenesis in Embryonic Development-A Review. Placenta. 2000;21:S11-S5.
42. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nature medicine. 1995;1(1):27-30.
43. Lloyd PG, Prior BM, Li H, Yang HT, Terjung RL. VEGF receptor antagonism blocks arteriogenesis, but only partially inhibits angiogenesis, in skeletal muscle of exercise-trained rats. American Journal of Physiology-Heart and Circulatory Physiology. 2005;288(2):H759-H68.
44. http://www.rndsystems.com/Pathway.aspx?p=18690&r=15436.
45. Chung HJ, Mahalingam M. Angiogenesis, vasculogenic mimicry and vascular invasion in cutaneous malignant melanoma – implications for therapeutic strategies and targeted therapies. Expert Review of Anticancer Therapy. 2014;14(5):621-39.
46. Mart?nez A. A new family of angiogenic factors. Cancer letters. 2006;236(2):157-63.
47. Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial growth factor (VEGF) and its receptors. The FASEB Journal. 1999;13(1):9-22.
48. Hoeben A, Landuyt B, Highley MS, Wildiers H, Van Oosterom AT, De Bruijn EA. Vascular endothelial growth factor and angiogenesis. Pharmacological reviews. 2004;56(4):549-80.
49. Hauk JM, Hosey RG. Nitric oxide therapy: fact or fiction? Current sports medicine reports. 2006;5(4):199.
50. B?ger RH, Ron ES. L-Arginine Improves Vascular Function by Overcoming the Deleterious Effects of ADMA, a Novel Cardiovascular Risk Factor. Alternative medicine review. 2005;10(1).
51. El Assar De La Fuente M, Angulo Frutos J, Vallejo Fern?n S, Peir? Vallejo C, S?nchez-Ferrer CF, Rodr?guez-Ma?as L. Mechanisms involved in the aging-induced vascular dysfunction. Frontiers in Physiology. 2012;3.
52. Tsai P-H, Tang T-K, Juang C-L, Chen K, Chi C-A, Hsu M-C. Effects of arginine supplementation on post-exercise metabolic responses. Chin J Physiol. 2009;52(3):136-42.
53. Alderton W, Cooper C, Knowles R. Nitric oxide synthases: structure, function and inhibition. Biochem J. 2001;357:593-615.
54. Bilusic M, Wong YN. Anti-angiogenesis in prostate cancer: knocked down but not out. Asian Journal of Andrology. 2014;16(3):372-7.
55. http://www.pdb.org/pdb/explore/explore.do?structureId=1KOE.
56. Heljasvaara R, Nyberg P, Luostarinen J, Parikka M, Heikkil? P, Rehn M, et al. Generation of biologically active endostatin fragments from human collagen XVIII by distinct matrix metalloproteases. Experimental cell research. 2005;307(2):292-304.
57. Sauter BV, Martinet O, Zhang W-J, Mandeli J, Woo SL. Adenovirus-mediated gene transfer of endostatin in vivo results in high level of transgene expression and inhibition of tumor growth and metastases. Proceedings of the National Academy of Sciences. 2000;97(9):4802-7.
58. Joki T, Machluf M, Atala A, Zhu J, Seyfried NT, Dunn IF, et al. Continuous release of endostatin from microencapsulated engineered cells for tumor therapy. Nature biotechnology. 2001;19(1):35-9.
59. Blezinger P, Wang J, Gondo M, Quezada A, Mehrens D, French M, et al. Systemic inhibition of tumor growth and tumor metastases by intramuscular administration of the endostatin gene. Nature biotechnology. 1999;17(4):343-8.
60. Sasaki T
, Fukai N, Mann K, G?hring W, Olsen BR, Timpl R. Structure, function and tissue forms of the C?terminal globular domain of collagen XVIII containing the angiogenesis inhibitor endostatin. The EMBO Journal. 1998;17(15):4249-56.
61. Digtyar A, Pozdnyakova N, Feldman N, Lutsenko S, Severin S. Endostatin: current concepts about its biological role and mechanisms of action. Biochemistry (Moscow). 2007;72(3):235-46.
62. Cao Y, Cao R, Veitonmaki N. Kringle structures and antiangiogenesis. Current Medicinal Chemistry-Anti-Cancer Agents. 2002;2(6):667-81.
63. Pestell RG, Li Z. Antisense to cyclin D1 inhibits VEGF-stimulated growth of vascular endothelial cells: implication of tumor vascularization. Clinical Cancer Research. 2006;12(15):4459-62.
64. Wernicke AG, Varma S, Greenwood EA, Christos PJ, Chao KSC, Liu H, et al. Prostate-specific membrane antigen expression in tumor-associated vasculature of breast cancers. Apmis. 2014;122(6):482-9.
65. Olsson A-K, Johansson I, ?kerud H, Einarsson B, Christofferson R, Sasaki T, et al. The minimal active domain of endostatin is a heparin-binding motif that mediates inhibition of tumor vascularization. Cancer research. 2004;64(24):9012-7.
66. Mott JD, Werb Z. Regulation of matrix biology by matrix metalloproteinases. Current opinion in cell biology. 2004;16(5):558-64.
67. Awata T, Inoue K, Kurihara S, Ohkubo T, Watanabe M, Inukai K, et al. A common polymorphism in the 5?-untranslated region of the VEGF gene is associated with diabetic retinopathy in type 2 diabetes. Diabetes. 2002;51(5):1635-9.
68. Howell W, Ali S, Rose-Zerilli M, Ye S. VEGF polymorphisms and severity of atherosclerosis. Journal of medical genetics. 2005;42(6):485-90.
69. Greenberger S, Boscolo E, Adini I, Mulliken JB, Bischoff J. Corticosteroid suppression of VEGF-A in infantile hemangioma-derived stem cells. New England Journal of Medicine. 2010;362(11):1005-13.
70. Simonetti O, Lucarini G, Goteri G, Zizzi A, Biagini G, Lo ML, et al. VEGF is likely a key factor in the link between inflammation and angiogenesis in psoriasis: results of an immunohistochemical study. International journal of immunopathology and pharmacology. 2005;19(4):751-60.
71. Paleolog EM, Young S, Stark AC, McCloskey RV, Feldmann M, Maini RN. Modulation of angiogenic vascular endothelial growth factor by tumor necrosis factor ? and interleukin?1 in rheumatoid arthritis. Arthritis & Rheumatism. 1998;41(7):1258-65.
72. Gealekman O, Burkart A, Nicoloro SM, Straubhaar J, Corvera S. Enhanced angiogenesis in obesity and in response to PPAR? activators through adipocyte VEGF and ANGPTL4 production. American Journal of Physiology-Endocrinology and Metabolism. 2008;295(5):E1056-E64.
73. Hoier B, Hellsten Y. Exercise?Induced Capillary Growth in Human Skeletal Muscle and the Dynamics of VEGF. Microcirculation. 2014;21(4):301-14.
74. Breen E, Tang K, Olfert M, Knapp A, Wagner P. Skeletal muscle capillarity during hypoxia: VEGF and its activation. High Altitude Medicine & Biology. 2008;9(2):158-66.
75. Laughlin M, Roseguini B. Mechanisms for exercise training-induced increases in skeletal muscle blood flow capacity: differences with interval sprint training versus aerobic endurance training. Journal of physiology and pharmacology: an official journal of the Polish Physiological Society. 2008;59(Suppl 7):71.
76. Richardson R, Wagner H, Mudaliar S, Henry R, Noyszewski E, Wagner P. Human VEGF gene expression in skeletal muscle: effect of acute normoxic and hypoxic exercise. American Journal of Physiology-Heart and Circulatory Physiology. 1999;277(6):H2247-H52.
77. Paniagua OA, Bryant MB, Panza JA. Role of Endothelial Nitric Oxide in Shear Stress-Induced Vasodilation of Human Microvasculature Diminished Activity in Hypertensive and Hypercholesterolemic Patients. Circulation. 2001;103(13):1752-8.
78. Dellamea BS, Leit?o CB, Friedman R, Canani LH. Nitric oxide system and diabetic nephropathy. Diabetology & metabolic syndrome. 2014;6(1):17.
79. Corbett EJ. Effects of Oral L-arginine

مقاله رایگان درمورد دماي، تصوير، ايزوله، pcr

آن‌‌ها، اختلاف پتانسيل و شدت جريان‌هاي مختلف، منابع تغذيه ولتاژ تانك‌هاي مختلف الكتروفورز و تانك‌هاي مختلف الكتروفروز و هم چنين زمان‌هاي مختلف الكتروفورز مورد ارزيابي و بررسي قرار گرفتند، كه بهترين حالت با ژل آگاروز با غلظت 5/1 درصد حل شده در بافر TBE (5X) و بافر تانك TBE(1X)، اختلاف پتانسيل 80 ولت و به مدت 1 ساعت با دستگاه الكتروفورز شركتBio Rad حاصل آمد.

3-7-مواد مورد نياز براي انجام الکتروفورز
3-7-1-ژل آگارز
3-7-1-1-طرز تهية ژل آگاروز
درصد ژل مورد استفاده در اين تحقيق 5/1 درصد بوده با توجه به درصد ژل، ميزان پودر آگاروز را محاسبه نموده و پس از وزن كردن، پودر را بسته به نوع تانك (بزرگ و يا كوچك بودن) با ميزان مناسب از بافر TBE(1X) در داخل بشر مخلوط کرده و بر حسب نوع استفاده با درصد خاص 5/1 به ترتيب به ميزان 5/1گرم از پودر آگاروز با 100سي‌سي بافر(1X) TBE مخلوط گرديده و پس از مخلوط كردن پودر آگاروز در بافر TBE1 X، آن را در مايكروويو قرار داده و پس از شفاف شدن محلول و رسيدن دماي آن به 50-45 درجه سانتيگراد سپس شانه را در داخل آن قرار داده، بايد به دقت به داخل قالب ريخته ‌شود و تا سرد شدن كامل ژل صبر نموده تا زماني كه ژل حالت شيري رنگي را پيدا نمايد.

3-7-1-2-تهيه بافر الكتروفورز
* محلول EDTA
* Buric acid
* Tris base (TBE-5X)
محلول ذخيره 5 بار غليظ TBE(5X) به صورت زير تهيه و در زمان مصرف با آب مقطر رقيق شد. ابتدا 7/3 گرم EDTA را به همراه54 گرم از تريس بيس و 5/ 27 گرم از بوريك اسيد را وزن کرده و با آب مقطر به حجم 900 ميلي ليتر مي‌رسانيم. pH آن را روي 8 تنظيم نموده و به حجم 1000 ميلي ليتر رسانديم.
3-7-1-3-بافر سنگين کننده (10x Sample bading Buffer)
اين بافر سنگين کننده محلول است تا از درون چاهک ژل خارج نشود و از طرفي مي‌توان محل محصولات PCR را بوسيله رنگ بروم فنل بلو که در جلو حرکت مي‌کند را مشاهده کرد. 6 ميکروليتر از محصول PCR را با 5/1 ميکروليتر لودينگ بافر مخلوط کرده و به آرامي توسط سمپلر درون چاهک ژل تخليه گرديد.
ماركرمولکلي(DNA Lader )مورد استفاده
ماركر مورد استفاده در اين تحقيق 1000 DNA Lader bp ساخت شركت Viogene با فاصله 100 جفت باز از وزن 100 وزن 3000 جفت باز بود كه براي مشخص كردن طيف گسترده‌اي از باندها با اندازه‌هاي مختلف وزن مولكولي تعبيه شده است.
3-7-1-4-رنگ آميزي ژل:
رنگ مورد استفاده در اين تحقيق اتيديوم برومايد تهيه شده از شركت سيناژن بود. مقدار 30 ميكروليتر از رنگ با 300 سي‌سي آب مقطر دو بار تقطير مخلوط هم زده و ژل الكتروفورز به مدت 20 دقيقه در آن قرار داده تا مراحل رنگ آميزي انجام شود. رنگ اتيديوم برومايد سرطانزا بوده و از ريختن آن دركف آزمايشگاه و يا تماس با پوست جداً خودداري گردد. و سپس شستشوي ژل در آب مقطر و سرانجام در دستگاه Gel documentation عمل عكسبرداري از ژل و ذخيره اطلاعات انجام مي‌گرديد.
اين رنگ ساخته شده براي رنگ‌آميزي ژل‌هاي متعددي مي‌تواند مورد استفاده قرار گيرد و نيازي به تعويض آن در هر بار رنگ‌آميزي نمي‌باشد. همچنين قبل از قرار دادن ژل در تشتك رنگ‌آميزي به خوبي آن را به هم زده تا رنگ در تمامي قسمت‌ها پخش گردد و باندها به طور يكسان رنگ‌آميزي گردند. محل نگهداري رنگ در قسمتي تاريك و دور از نور آفتاب مي‌باشد. از ريختن آب گرم بر روي رنگ بعد از تعويض و ريختن آن در سينك ظرفشويي جهت جلوگيري از ايجاد بخارات سمي اكيداً خودداري شود. پس از رنگ‌آميزي مرحله شستشو در آب مقطر مي‌باشد به مدت 10 دقيقه ژل را از رنگ خارج و در آب مقطر جهت شستشو شدن قرار مي‌دهيم و پس از گذشتن زمان مذكور آن را بر روي صفحه دستگاه ژل داك قرار داده و از آن عكس گرفته مي‌شود. پس از انجام عكسبرداري و ذخيره كردن، ژل با دستكش درون پلاستيك قرار داده شده و در چاه مخصوص انداخته مي‌شود.
3-8-توالي‌يابي (sequencing)
پس از اتمام PCR، محصولات PCR در فريزر20- نگهداري گرديدند، سپس به همراه پرايمر به شركت پيشگام ارسال گرديد. محصولات PCR توسط اين شرکت براي توالي‌يابي به کشور کره ارسال گرديد. علاوه بر اين براي اطمينان بيشتر توالي ژن مورد نظر در سايت NCBI بلاست گرديد و صحت وجود ژن مورد نظر مورد تاييد قرار گرفت.
3-9-1- روش گرد آوري اطلاعات
ميداني: نمونه برداري از نمونه هاي ادرار مبتلا به عفونت ادراري
کتابخانه اي: انتخاب پرايمرهاي مناسب جهت هدف قرار دادن ژن هاي ويرولانس
آزمايشگاهي: جداسازي ايزوله ها و شناسايي ژن هاي ويرولانس ابزار گرد آوري اطلاعات
1. بانک هاي اطلاعاتي مانند اينترنت
2. نشريات معتبر جهت دستيابي به مقالات مرتبط با موضوع
3. جمع آوري نمونه هاي ادراري به منظور جداسازي اشريشيا کلي

3-9-2- روش تجزيه و تحليل اطلاعات
1. تکثير توالي هاي اختصاصي (ژن هاي ويرولانس) با استفاده از تکنيک PCR
2. تجزيه و تحليل باندها (اثر انگشت با استفاده از نرم افزار Image lab
3. بررسي آماري جهت تجزيه و تحليل داده ها : از نرم افزار SPSS نسخه 18 و همچنين جهت رسم
نمودارها و جداول از نرم افزار Microsoft Office Excel 2013 استفاده شد. مقايسه الگوهاي باندي DNA مربوط به ويرولوتايپ ها با رويت و محاسبه نحوه قرارگيري آن ها در ژل بر اساس وزن مولکولي آن ها ومقايسه با مارکر مولکولي و شمارش باندها جهت هر نمونه صورت گرفت. يک ماتريکس صفر و يک به منظور وجود يا عدم وجود باند تهيه و در پايگاه اينترنتي ثبت شد و ويرولوتايپ ها بر پايه مشاهده ي نحوه قرارگيري آن ها در ژل براساس وزن مولکولي آن ها و مقايسه با مار
کر مولکولي و شمارش باندها جهت هر نمونه انجام گرفت. شمارش سويه هاي واجد ژن ويرولانس و درصد گيري نسبت به کل نمونه ها مبناي درصد شيوع فاکتور ويرولانس مي باشد.
فصل چهارم
نتايج و بحث

4-1- فراواني بيماران بر اساس جنس
در مجموع از کل بيماران که مورد مطالعه قرار گرفتند 18 مورد، 18 درصد مذکر و 82 مورد، 82 درصد مونث بودند.(نمودار 4-1)

نمودار 4-1: فراواني بيماران بر اساس جنس

بيماران بر اساس سن در 4 گروه سني(Age) شامل: کودک کمتر از يک سال، نوجوان، جوان و مسن تقسيم بندي گرديدند. 4 مورد(4%) در گروه سني کمتر از يک سال، 3 مورد (3%) نوجوان، 63 مورد(63%) جوان و 30 مورد(30%) در گروه سني افراد مسن قرار داشتند.(نمودار4-2)

نمودار4-2: فراواني بيماران براساس سن(سال)

4-2-نتايج مربوط به فراواني فاکتورهاي حدت در اشرشيا کلي
بررسي هاي ويرولوتيپينگ ايزوله هاي اشرشيا کلي که توسط تکنيک PCR انجام گرديد نشان داد که 98% از ايزوله ها متعلق به ژن Pap، 95% از ايزوله ها متعلق به ژن aer ، 94% ايزوله ها متعلق به ژن Fim، 86% از ايزوله ها متعلق به ژن cnf ، 63% از ايزوله ها متعلق به ژن Afa ، 62% از ايزوله ها متعلق به ژن hlyA بودند. نمودار(4-3)

نمودار 4-3: نتايج مربوط به فراواني فاکتورهاي حدت در اشرشيا کلي

4-3- نتايج آزمون PCR براي شناسايي ژن آئروباکتين در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.

4-3-1-بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4-1 ) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 68 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 23 انتخاب گرديد).

تصوير4-1: دماهاي انتخاب شده براي انجام گراديانت دمايي جهت انتخاب دماي اتصال در يک واکنش pcr براي ژن aer، به ترتيب شماره از چاهک 1 الي 4 عبارتند از 69-68-67-66 درجه سانتي گراد و در سمت چپ مارکر مولکولي bp 1000 مي باشد.

4-3-1-1- انجام آزمون روي ساير ايزوله ها
پس از بهينه نمودن روش کار، آزمايش pcr بر روي ساير نمونه ها ي باليني صورت گرفت که با توجه به باندهاي بدست آمده، تصاوير همه باندها واضح بوده و طبق انتظار محصول pcr ما bp 602 تصوير (4-1-1-)(4-1-2-).

تصوير 4-1-1: نتايج pcr به منظور تکثير ژن aer در ساير ايزوله هاي باليني توسط مارکر مولکولي bp 1000 اعداد بالاي چاهکها مربوط به شماره ايزوله ها مي باشد.

تصوير شماره 4-1-2-: نتايج PCR بر روي برخي نمونه هاي باليني. رديف هاي 1 تا 4 نمونه هاي مثبت واجد ژن آئروباکتين و رديف هاي 5 و 6 به ترتيب نمونه کنترل منفي و نمونه فاقد ژن آئروباکتين. رديف MW مارکر مولکولي 1000 جفت بازي مي باشد.

4-3-2- نتايج آزمون PCR براي شناسايي ژن سايتوتوکسيک نکروزدهنده در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-3-2-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4- 2) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 57 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 5 انتخاب گرديد).

تصوير 4-2: دماهاي انتخاب شده براي انجام گراديانت دمايي جهت انتخاب دماي اتصال در يک واکنش pcr براي ژن cnf، به ترتيب شماره از چاهک 1 الي 7 عبارتند از 57-56-55-54-53-52- 51درجه سانتي گراد و در سمت چپ مارکر مولکولي bp 1000 مي باشد.
4-3-2-2- انجام آزمون روي ساير ايزوله ها
پس از بهينه نمودن روش کار، آزمايش pcr بر روي ساير نمونه ها ي باليني صورت گرفت که با توجه به باندهاي بدست آمده، تصاوير همه باندها واضح بوده و طبق انتظار محصول pcr ما bp 693 تصوير (4-2-1).

تصوير شماره 4-2-1: نتايج PCR بر روي برخي نمونه هاي باليني. رديف هاي C+ و C- به ترتيب کنترل مثبت و منفي، و رديفهاي 1و2،نمونه هاي منفي فاقد ژن و رديف 3 نمونه واجد ژن فاکتور نکروز دهنده سايتوتوکسيک. رديف MW مارکر مولکولي 1000 جفت بازي مي باشد.

4-3-3- نتايج آزمون PCR براي شناسايي ژن هموليزين در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-3-3-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4-3) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 62 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 5 انتخاب گرديد).

تصوير شماره4-3: دماي مناسب براي ژن hlya 62 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود نيازي به انجام گراديانت دمايي احساس نشد

4-4-4- نتايج آزمون PCR براي شناسايي ژن p-فيمبريه در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-4-4-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4- 4) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 63 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر ش
ماره 2 انتخاب گرديد).

تصوير شماره4-4: دماهاي انتخاب شده براي انجام گراديانت دمايي جهت انتخاب دماي اتصال در يک واکنش pcr براي ژن pap، به ترتيب شماره از چاهک 1 الي 7 عبارتند از 69-68-67-66-65-64-64درجه سانتي گراد و در سمت چپ مارکر مولکولي bp 1000 مي باشد.
4-4-4-2- انجام آزمون روي ساير ايزوله ها
پس از بهينه نمودن روش کار، آزمايش pcr بر روي ساير نمونه ها ي باليني صورت گرفت که با توجه به باندهاي بدست آمده، تصاوير همه باندها واضح بوده و طبق انتظار محصول pcr ما bp 328 تصوير (4-4-1-).

تصوير شماره4-4-1: نتايج PCR به منظور تکثير ژن Pap در برخي ايزوله هاي باليني توسط مارکر مولکولي bp 1000، اعداد بالاي چاهک ها مربوط به شماره ايزوله ها مي باشد.

4-5-5- نتايج آزمون PCR براي شناسايي ژن Afa در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-5-5-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4- 5) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 65 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 9 انتخاب گرديد).

تصوير 4-5: دماهاي انتخاب شده براي انجام گراديانت دمايي جهت انتخاب دماي اتصال در يک واکنش pcr براي ژن Afa، به ترتيب شماره از چاهک 1 الي 6 عبارتند از 69-68-67-66-65-64درجه سانتي گراد و در سمت چپ مارکر مولکولي bp 1000 مي باشد.

4-5-5-2- انجام آزمون روي ساير ايزوله ها
پس از بهينه نمودن روش کار، آزمايش pcr بر روي ساير نمونه ها ي باليني صورت گرفت که با توجه به باندهاي بدست آمده، تصاوير همه باندها واضح بوده و طبق انتظار محصول pcr ما bp 750 تصوير (4-5-1).

تصوير 4-5-1: نتايج PCR به منظور تکثير ژن Afa در برخي ايزوله هاي باليني توسط مارکر مولکولي bp 1000، اعداد بالاي چاهک ها مربوط به شماره ايزوله ها مي باشد.
4-6-6- نتايج آزمون PCR براي شناسايي ژن Fim در سويه هاي واجد اشرشيا کلي يوروپاتوژن PCR با کمک پرايمرهاي اختصاصي که در فصل سوم ذکر شد انجام گرديد.
4-6-6-1- بهينه سازي دماي اتصال
به منظور انتخاب مناسب ترين دماي اتصال، گراديانت دمايي مطابق(تصوير 4- 6) انجام گرديد. طبق تصوير باندهاي بدست آمده از pcr توسط پرايمر هاي فوروارد و ريورس دماي بهينه 59 درجه سانتي گراد انتخاب گرديد چون وضوح باند در اين دما بهتر بود( نمونه مورد نظر شماره 11 انتخاب گرديد).

تصوير 4-6: نتايج PCR به منظور تکثير ژنFim در برخي ايزوله هاي باليني توسط مارکر مولکولي bp 1000، اعداد بالاي چاهک ها مربوط به شماره ايزوله ها مي باشد.

مقاله رایگان درمورد دمايي، دقيقه، دماي، پرايمر

ن مي‌دهد. اين نسبت بايد بين 8/1 تا 2 باشد. اگر نسبت كوچك‌تر از 8/1 باشد، آلودگي DNA را با پروتئين يا فنل نشان مي‌دهد و نسبت بزرگتراز 2 به دليل وجود RNA در نمونه مي باشد.6

از تقسيم جذب نوري (OD) در طول موج 260 نانومتر به جذب نوري در طول موج 280 نانومتر ميزان خلوص نمونه ي DNA بدست آمد به اين صورت که با از دستگاه NANO DROP که متصل به کامپيوتر مي باشد ابتدا مقدار کمي در حد يک حباب آب مقطر ريخته و سپس Blank را زده تا دستگاه آماده اندازه گيري شود و سپس مقدار 1? از ژنوم را در جايگاه مورد نظر ريخته و سپس با زدن کليد Measure عمل محاسبه انجام مي گيرد و تصويري همراه با نمودار از ژنوم روي صفحه کامپيوتر حاصل مي شود (تصوير شماره3-1).

تصوير شماره 3-1 : کميت سنجي و غلظت سنجي DNA استخراج شده با استفاده از دستگاه NANO DROP
3-5-5- انجام آزمايشات مولکولي:
3-5-5-1- پرايمر ها:
براي اين منظور ابتدا توالي ژن هاي مورد نظر از پايگاه داده ها NCBI استخراج و سپس يک جفت پرايمر اختصاصي براي هر ژن با استفاده از نرم افزار آنلاين Primer3 با آدرس سايتي (http://frodo.wi.mit.edu/primer3) طراحي گرديد. در ادامه ميزان اختصاصي بودن پرايمرها با استفاده از Primer-blast با آدرس اينترنتي (http://www.ncbi.gov/tools/primer-blast )مورد ارزيابي قرار گرفت و به منظور آناليز جهت اطمينان از ساختارهاي ثانويه از نرم افزار oligo analyzer استفاده شد. طبق بررسي هاي به عمل آمده و مرور مطالعات توسط محققين جفت پرايمرهاي مناسب انتخاب و جهت تهيه به شرکت پيشگام سفارش داده شد. پرايمرها مهمترين عامل در موفقيت يا عدم موفقيت واکنشPCR هستند و معمولاً براساس توالي شناخته شده DNA الگو طراحي مي شوند. اگر پرايمرها به طور صحيح طراحي شده باشند واکنش PCR منجر به تکثير قطعه اي از DNA مي شود که با ناحيه هدف مولکول الگو مطابقت دارد و در صورتي که پرايمرها به طور صحيح طراحي نشوند واکنش با شکست روبه رو مي شود. در اين حالت هيچ قطعه اي تکثير نخواهد شد و يا اينکه قطعات اشتباهي تکثير خواهند شد(جدول 3-1).

جدول 3-1- مشخصات پرايمر هاي مورد استفاده
ژن هدف
? (3-5 ) سکانس پرايمر
تعداد نوکلئوتيد
وزن مولکولي
Cnf
F: TTATATAGTCGTCAAGATGGA

R: CACTAAGCTTTACAATATTGA

21
21
639
Pap
F: GAC GGC TGT ACT GCT GGG TGT GGC G

R: ATA TCC TTT CTG CAG GGA TGC AATA

25
25
328
HlyA
F: AACAAGGATAAGCACTGTTCTGGCT

R: ACCATATAAGCGGTCATTCCCGTCA

25
25
1177
Afa
F: GCTGGGCAGCAAACTGATAACTCTC

R: CATCAAGCTGTTTGTTCGTCCGCCG
25
25
750
Fim
F:GAGAAGAGGTTTGATTTAACTTATTG

R: AGAGCCGCTGTAGAACTGAGG
26
21
559
Aer
F: TACCGGATTGTCATATGCAGACCGT

R: AATATCTTCCTCCAGTCCGGAGAAG
25
25
602
3

3-5-5-2-رقيق سازي پرايمرها:
طبق دستور العمل شرکت سازنده براي رقيق سازي هر کدام از پرايمرها طبق فرمول زير عمل شد:
N1V1=N2V2 100(PM) × X=10 (PM) × 100(µL) ? 20(µL)
ابتدا پرايمرهاي موجود براي ژن هاي اختصاصي براي همه ژن هاي ويرولانس (که به صورت ليوفيليزه بودند) طبق دستورالعمل ارسال شده از طرف شرکت پيشگام تا غلظت PMOL/ µL100 با آب مقطر دوبار استريل رقيق شده و به عنوان استوک براي نگهداري طولاني مدت در فريزر20- درجه منتقل شد و محلول کاري با اضافه کردن µL 90 آب مقطر به µL 10 محلول استوک فراهم شد.
3-5-6- PCR
3-5-6-1-بهينه سازي اجزاء واکنش PCR
واکنش PCR در شرايط توصيه شده توسط ساير محققين در دستگاه مستر سايکلر اپندورف گراديانت طبق جدول زير انجام گرديد، اجزا و ترکيبات مورد استفاده براي واکنش PCR براي تمامي 6 ژن يکسان مي باشد (جدول شماره 3-2)

جدول 3-2: اجزاء و ترکيبات مورد استفاده براي واکنش PCR
اجزاي واکنش
غلظت
حجم(ميکروليتر)
مستر ميکسAmpliqon واجد Taq DNA polymerase به همراه بافر) dNTP (2X وکلريد منيزيم
X2
10
پرايمر فوروارد
10 پيکومول/ ميکروليتر
1
پرايمر ريورس
10 پيکومول/ ميکروليتر
1
ژنوم

1
آب مقطر آمپولي استريل

7
حجم نهايي

20

3-5-6-2-بهينه سازي تهيه Master Mix
در ابتدا بدون تهيه رقت از پرايمرها مستر ميکس تهيه شد و به طور تصادفي از ژنوم استخراج شده شماره 23، PCR انجام شد که پس از مراحل الکتروفورز و رنگ آميزي تجمع پرايمر محسوس بود. سپس با تهيه رقت از پرايمر طي چند مرحله، در نهايت رقت 20(pm) و حجم 2(µl) بدست آمد، که با انجام PCR جواب هاي قابل قبولي حاصل شد.

3-5-7- گراديانت دمايي جهت بدست آوردن دماي اتصال براي ژن aer
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 23 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از 69-68-67-66 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 68 درجه در ژن aer استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن aer در( جدول شماره 3-3) آمده است.

جدول 3-3: برنامه دمايي ترموسايکلر براي ژن aer
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°68
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3-5-7-1-گراديانت دمايي جهت بدست آوردن دماي اتصال براي ژن HlyA
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 5 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از 67-66-65-64-63-62-61-60-59-58 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 62 درجه در ژن HlyA استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن HlyA در( جدول شماره 3-4) آمده است.

جدول 3-4: برنامه دمايي ترموسايکلر براي ژن HlyA
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°62
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3-5-7-2- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Pap
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 2 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از72-71-70-69-68-67-66-65-64-63-62-61 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 63 درجه در ژن Pap استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن Pap در( جدول شماره 3-5)آمده است.

جدول 3-5 : برنامه دمايي ترموسايکلر براي ژن Pap
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30

1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°63
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3-5-7-3- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Cnf
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 5 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از59-58-57-56-55-54-53-52-51 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 57 درجه در ژن CNF استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن CNF در( جدول شماره 3-6)آمده است.

جدول 3-6: برنامه دمايي ترموسايکلر براي ژن CNF

مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30

1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°57
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3
3-5-7-4- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Afa
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 1 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از67-66-65-64-63-62-61-60-59-58-57 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 65 درجه در ژن Afa استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنشPCR براي ژن Afa در( جدول شماره 3-7)آمده است.

جدول 3-7: برنامه دمايي ترموسايکلر براي ژن ژن Afa
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°65
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3
3-5-7-5- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Fim
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 11 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از64 -63-62-61-60-59 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 59 درجه در ژن Fim استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن Fim در( جدول شماره 3-8)آمده است.

جدول 3-8: برنامه دمايي ترموسايکلر براي ژن Fim
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°59
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

. 3-6-مراحل انجام PCR
مرحله واسرشتي او
ليه1: در اين مرحله ابتدا با استفاده از حرارت دو رشته DNA از هم باز مي شوند. مطابق با جدول دماي دناتوراسيون C°95 و زمان مورد نياز معمولاً 5دقيقه است.
از اين مرحله به بعد وارد برنامه چرخه اي PCR مي شويم كه خود شامل سه مرحله است:
مرحله واسرشتي2: اين مرحله نيز مانند مرحله واسرشتي اوليه، اما با زماني كوتاهتر از آن انجام مي گيرد. دو رشته DNA بطور كامل در اين مرحله از هم جدا مي شوند. دماي مورد استفاده در اين مرحله 95درجه سلسيوس به مدت 30 ثانيه است.
مرحله اتصال3 :در اين مرحله با پايين آوردن دما و رساندن آن به حد مناسب تلاش مي شود تا پرايمرها بتوانند با رشته مكمل خود در DNA الگو جفت شوند.
مرحله طويل شدن4: دما بايد براي فعاليت آنزيم پليمراز مناسب باشد و در اين مرحله رشته مكمل رشته الگو ساخته خواهد شد و از آنجا كه رشته هاي ساخته شده جديد نيز مكمل آغازگرها هستند، اين چرخه حرارتي مي تواند چندين بار تكرار شود و به همين طريق ساخت و تكثير قطعات ادامه مي يابد. دماي اين مرحله 72 درجه سلسيوس مي باشد كه براي فعاليت آنزيم پليمراز مناسب است.7

3-6-1-بهينه‌سازي PCR
بهينه‌سازي يعني تعيين غلظت‌هاي مناسب مواد واكنشگر و دماي مناسب اتصال پرايمرها (Tm) جهت به دست آوردن محصول PCR مناسب براي اين منظور براي هر يك از پارامترها مثلTm آزمايشات مختلف انجام شد سپس با بررسي محصول و نوع پرايمرها و نيز شرايط واكنش، بهترين دما و سيكل انتخاب گرديد.
به منظور بدست آوردن دماي مناسب براي هر يک از پرايمرها جهت انجام واکنش PCR، نمونه کنترل مثبت را با يک جفت پرايمر گراديانت دمايي گذاشتيم و دماي مناسب هر يک گزارش شد.
عمل بهينه نمودن واكنش با تغييرات جزء به جزء و مرحله به مرحله در غلظت‌هاي DNA الگو، پرايمر، dNTPs، MgCI2، polymerase DNA Taq و بهترين دماي Annealing صورت گرفت تا اينكه شرايط بهينه جهت تكثير ژن‌هاي ويرولانس حاصل آمد.
3-6-2- بررسي محصول PCR
جهت آشكارسازي محصول PCR از روش متداول و سريع الكتروفورز ژل آگاروز و رنگ‌آميزي با اتيديوم برومايد براي آشكارسازي سكانس هدف تكثير يافته استفاده مي‌كنيم.
آگارز پلي ساكاريدي است كه در اثر حرارت در بافر مناسب خود به صورت‌ ژله‌اي با آرايش پليمري منظم و قطر منافذ مشخص در مي‌آيد. اين منافذ امكان عبور ماكرومولكول‌هاي DNA را در ژل آگاروز حين انجام الكتروفورز از قطب منفي (كاتد) به سمت قطب مثبت (آند) فراهم مي‌كند. غلظت بالاتر ژل آگاروز سبب ايجاد منافذ ريزتر مي‌شود كه قدرت تفكيك اندازه ‌DNA کوچکتري را فراهم مي‌كند.
با دانستن طول سكانس هدف، غلظت ژل آگاروز را براي بررسي محصول PCR خود تعيين كرده و ژل مناسب را تهيه نموديم.
حدود 6 ميكروليتر از نمونه‌ها با 5/1 ميكروليتر از بافر لود كننده با غلظت 6 شركت سيناژن، به خوبي مخلوط گرديده و در چاهك‌هاي ژل قرار داده مي‌شدند.
جهت بهينه نمودن الكتروفورز، اين عمل در حالات و شرايط مختلف آزمايش گرديد. بدين منظور انواع آگاروز از شركت‌هاي خارجي از جمله Gibco BRL, Bio Rad, Digma, Roche هم چنين انواع بافرها با غلظت‌ها و نسبت‌هاي مختلف مواد تشكيل دهنده

مقاله رایگان درمورد کلي، سويه، اشرشيا، شناسايي

مي شود که به سلول باکتري اجازه اتصال به سطح آنتروسيت را داده و موجب بروز حرکات تيپيک اتصال و محو شدن مي گردد(ون و همکاران، 2001)3.29

جدول شماره (1-1): ژن هاي ويرولانس در اشريشيا کلي و عملکرد ژن ها
ژن
پاتوتيپ
عملکرد
موقعيت ژنتيکي
آئروباکتين
اشرشيا کلي يوروپاتوژن
دفاعي
جزاير پاتوژنيسته
آلفا- هموليزين
اشرشيا کلي يوروپاتوژن
توکسين
پلاسميد ; ترانسپوزوم
سايتوتوکسيک نکروز دهنده
اشرشيا کلي يوروپاتوژن
توکسين
پلاسميد ; ترانسپوزوم
فيمبريه نوع I
اشرشيا کلي يوروپاتوژن
ادهسين
جزاير پاتوژنيسته
-P فيمبريه
اشرشيا کلي يوروپاتوژن
ادهسين
جزاير پاتوژنيسته
افمبريال- ادهسين
اشرشيا کلي يوروپاتوژن
ادهسين
جزاير پاتوژنيسته

1-9-1-3- مکانيسم بيماري زايي UPEC در ارتباط با افمبريال ادهسين (afa, foc, sfa, fim, pap,):
UPEC داراي فاکتورهاي اتصالي هستند به نام پيلي يا فيمبريه، که به آنها اجازه مي دهد تا به طور موفقيت آميزي عفونت را آغاز کنند (تيبا و همکاران، 2008).ادهسين ها آنتي ژن هاي فيمبريالي هستند که باکتري را قادر مي سازند تا به موکوس روده متصل شود (مولوي، 2002). از ادهسين هاي معمول موجود در اشرشيا کلي يوروپاتوژن مي توان به P فيميريا، فيمبريا نوع 1، S فيمبريا، FIC فيمبريا و خانواده ادهسين Dr و ادهسين هاي افمبريال مي باشد، نام برد. اين فيمبريه ها به ترتيب توسط ژنهاي(Afa, foc, sfa, Fim, Pap) کد مي شوند (ميازاکي و همکاران، 2002). در UPEC، فيمبريا نوع 1 مهمترين عامل حدت است. تعدادي از اعضاي خانواده انتروباکترياسه اين ژن را توليد مي کنند. فيمبريه نوع 1 به وسيله بيش از 90% سويه هاي اشرشيا کلي بيان مي شود. اين فيمبريه اتصال به گليکو پروتئين هاي ترشح شده و گليکو پروتئين هاي مانوزيله شده اي را که به سلول متصل شده اند وساطت مي کند. P-فيمبريه، ضمائم هتروپلي مريک سخت ميله مانندي هستند که از سطح سلول اشرشيا کلي بيرون زده اند و نشان داده شده است که در بيشتر از 70% اشرشيا کلي پيلونفريتوژن حضور دارد(چورمک، 2006). FIC فيمبريه به وسيله کلاستر ژن foc کد مي شود، يک فاکتور اتصالي غير هماگلوتينه کننده است که به وسيله تقريباً 14% از اشرشيا کلي ايجاد کننده عفونت دستگاه ادراري و 7% از سويه هاي مدفوعي اشرشيا کلي بيان مي شود. اين فيمبريه از نظر ژنتيکي مشابه S فيمبريه است اما از نظر اختصاصيت رسپتورهايشان با يکديگر متفاوتند(ناظمي و همکاران، 2010). S-فيمبريه به رسپتورهاي حاوي بخش هاي قندي اسيد سياليک متصل مي شود و در اشرشيا کلي ايجاد کننده سپتيس و پيلونفريت حضور دارد(مولوي، 2002). افمبريال ادهسين ها از نظر خصوصيات مورفولوژي و بيوشيميايي با ديگر ادهسين ها تفاوت دارند و توسط ژن afa کد مي گردند و نشان داده شده است که در ايجاد عفونت دستگاه ادراري داراي نقش مي باشند (تصوير شماره 1-2).

تصوير شماره (1-2): شکل شماتيک از نحوه اتصال باکتريE.coli به سطح سلول هاي اپيتليال سطحي بدن
1-9-1-4- مکانيسم بيماري زايي UPEC در ارتباط با سايتوتوکسيک نکروز دهنده(cnf):
سويه هاي بيماري زا قابليت توليد و نمود طيف وسيعي از عوامل حدت را دارند که بر اين اساس به پاتوتيپ هاي مختلفي از جمله انتروتوکسيژن(ETEC)، نکروتوکسيژنNTEC))، توليد کننده شيگا توکسين(STEC) و غيره تقسيم مي شوند. سويه هاي نکروتوکسيژن(NTEC) براي اولين بار دراسهال نوزادان گزارش شد(اولت و همکاران، 2007). در ميان محصولات، سيتوتوکسيک نکروز دهنده CNF1),(CNF2)) ممکن توکسين هاي ديگري نظير توکسين هاي تورم دهنده کشنده سلول (CDT)، هموليزين (hly)، P – فيمبريه (pap)، افمبريال ادهسين (afa)، Sفيمبريه (sfa)و …باشند. سويه هاي نکروتوکسيژن قادرند عامل سيتوتوکسيک نکروز دهنده (CNF) توليد کنند که موجب چند هسته اي شدن سلول ها در کشت سلول و نکروز پوست خرگوش مي گردد(الکس و همکاران، 2001).در سويه هاي اشرشيا کلي نکروتوکسيژن جدا شده از عفونت هاي مختلف انسان ودام ها سه نوع از توکسين هاي مذکور تحت عنوان عامل سيتوتوکسيک نکروز دهنده 1و2و3 CNF1, CNF2 ,CNF3)) شناسايي و گزارش شده است. عامل سيتوتوکسيک نکروز دهنده 2و1 پروتئين هاي مقاوم به حرارت بوده و از نظر وزن مولکولي تقريباً مشابه مي باشند و توالي نوکلئوتيدي ژن هاي کد کننده آنها 7/85 درصد مشابهت با يکديگر را نشان مي دهند(بلنکو وهمکاران،1993; بلنکو و همکاران، 1998). سويه هاي نکروتوکسيژن( NTEC1 و NTEC2 ) که به ترتيب عوامل سيتوتوکسيک نکروز دهنده 1و2 را توليد مي کنند از نظر ژنتيکي و ساختار آنتي ژني به يکديگر شباهت داشته و متعلق به گروه هاي سرومي يا سروتيپ هاي مختلف مي باشند(اسواد و همکاران، 1994; آماويزيت و همکاران، 2001). ژن کد کننده عامل سيتوتوکسيک نکروز دهنده 1 بر روي کروموزوم باکتري قرار داشته و معمولاً با ژن هاي کد کننده هموليزين و فيمبريه هاي P و S همراه است. سويه هاي نکروتوکسيژن 1 تاکنون از موارد عفونت هاي گوارشي نشخوارکنندگان، خوک، سگ و همچنين از عفونت هاي خارج گوارشي (نظير عفونت هاي ادراري) انسان جدا شده است(توت و همکاران، 2001; ون و همکاران، 2001). ژن کد کننده عامل سيتوتوکسيک نکروز دهنده 2 بر روي پلاسميدي به نام Vir قرار دارد و ممکن است با اپران هاي کد کننده عوامل فيمبريه اي F17 و يا غير فيمبريه اي Afa8 همراه باشد اما سويه هاي نکروتوکسيژن 2 عمدتاً از نشخوارکنندگان با علائم عفونت گوارشي يا سپتي سمي جدا مي گردد. عامل سيتوتوکسيک نکروز دهنده 3 که به تازگي در جدايه هاي اشرشيا ک
لي از بره و بزغاله هاي سالم و بيمار شناسايي شده است داراي مشابهت هايي با عوامل 1و2 است(الکس و همکاران،2001)1. ژن کد کننده اين فاکتور بر خلاف ژن هاي عامل سيتوتوکسيک نکروز دهنده 1و2 با ژن هاي کد کننده انتيمين و انتروهموليزين همراه است. در سال هاي اخير توکسين هاي تورم دهنده کشنده سلول (CDTs) در سويه هاي مختلف اشرشيا کلي شناسايي شده است که شامل 4 واريانت مي باشد اين توکسين ها موجب توقف تقسيم سلولي در مرحله G2/M مي شوند. توکسين هاي تورم دهنده کشنده سلول نوع 1و2 (CDT-I,CDT-II) از نظر وابستگي با سويه هاي نکروتوکسيژن مورد توجه نيستند اما دسته ژن هاي کد کننده توکسين تورم دهنده سلول نوع 4 (CDT-IV) بر روي کروموزوم قرار دارند و به همين دليل همواره با عامل سيتوتوکسيک نکروز دهنده 1 همراه است(نعمتي و همکاران، 2012). در حالي که دسته ژن هاي کد کننده نوع 3 (CDT-III) بر روي پلاسميد Vir قرار داشته و به همراه عامل سيتوتوکسيک نکروز دهنده 2 شناسايي مي گردد. تاکنون حضور توکسين هاي تورم دهنده کشنده سلول در سويه هاي نکروتوکسيژن نوع 3 گزارش نشده است. به تازگي دسته پنجمي از توکسين هاي تورم دهنده کشنده سلول در سويه اي انتروپاتوژنيک جدا شده از دام ها شناسايي و گزارش شده است که با ژن شيگا توکسين همراه است(توچان و همکاران، 2009)2.30
شيوع ژن توليد کننده CNF در اشرشيا کلي مرتبط با عفونت ادراري به طور گسترده اي گزارش شده است. علاوه بر اين، شرايط ميزبان مانند سن بالا و زمينه هايي مانند انسداد مجاري ادراري، ديابت شيرين و ضعف مثانه به کلونيزاسيون باکتري کمک کرده و نقش مهمي در عفونت ادراري دارد(گالز و همکاران، 2002; يولرد، 2003). تحقيقات نشان مي دهد که شيوع فاکتورهاي ويرولانس در سويه هاي UPEC با پاتوژنيسته ادراري در ارتباط است، سويه هاي UPEC انواع مختلف توکسين ها مانند هموليزين و CNF1 را توليد مي کنند تا محيط داخل بدن ميزبان را براي ايجاد عفونت آماده کنند. معمولاً بيان اين دو توکسين در راستاي يکديگر و نزديک به هم هستند.
1-9-1-5- مکانيسم بيماري زايي UPEC در ارتباط با هموليزين(hlyA):
دو نوع هموليزين توسط اشرشيا کلي توليد مي شود : 1) نوع ترشحي 2) متصل به سلول
آنها گلبول هاي سرخ و سفيد را پاره کرده و ممکن است از عمل بيگانه خواري جلوگيري کند. سويه هاي بيماري زاي اشرشيا کلي حاوي يک آندوتوکسين بوده که اثرات آن شبيه به ساير آندوتوکسين ها مي باشد. همچنين اين باکتري ها توليد نوع III سيستم ترشحي مي کند تا بتواند مولکول هاي موثر را مستقيماً وارد سلول باکتري نمايد. اين سيستم همچنين مي تواند سويه هاي تهاجمي اشرشيا کلي را وارد سلول هاي روده اي نمايد. اتصال از طريق پيلي و فيمبريه و انتيمين صورت مي گيرد فاکتورهاي بيماري زايي که کمک به تهاجم باکتري و بيماري زايي آن مي کند شامل کپسول مي باشد (تصوير شماره 1-3)(تصوير شماره1-4).

تصوير شماره (1-3): شکل شماتيک از فاکتورهاي ويرولانس در اشرشيا کلي

تصوير شماره (1-4): مکانسيم بيماري زايي UPEC
1-10-تعاريف واژه ها :
اشريشيا کلي : اشريشيا کلي باسيل گرم منفي، متعلق به خانواده انتروباکترياسه، بدون اسپور و متحرک به وسيله تاژ هاي پيراموني است.
تکنيک PCR (واکنش زنجيره اي پليمراز) : اين تکنيک مجموعه اي از واکنش هاي بيوشيميايي است که در طي آن قطعه مشخصي از DNA به طور تصاعدي تکثير مي يابد، بدين ترتيب مقادير انبوهي از DNA هدف ايجاد مي گردد.
عفونت دستگاه ادراري (UTI) نوعي عفونت باکتريايي است که بر بخشي از دستگاه ادراري تأثير مي‌گذارد. هنگامي که عفونت دستگاه ادراري تحتاني را مبتلا مي‌کند سيستيت ساده (عفونت مثانه) ناميده مي‌شود و هنگامي که بر دستگاه ادراري فوقاني تأثير مي‌گذارد به آن پيلونفريت (عفونت کليه) گفته مي‌شود.
ويرولوتايپينگ: دسته بندي تيپ هاي باکتري بر اساس وجود يا عدم وجود ژن هاي ويرولانس و بررسي رابطه ي خويشاوندي آنها مي باشد.
سيستيت : نوعي عفونت باکتريايي است که بر بخشي از دستگاه ادراري تأثير مي‌گذارد. هنگامي که عفونت دستگاه ادراري تحتاني را مبتلا مي‌کند سيستيت ساده (عفونت مثانه) ناميده مي‌شود.
پيلونفريت : نوعي عفونت باکتريايي است که بر بخشي از دستگاه ادراري تأثير مي‌گذارد. هنگامي که بر دستگاه ادراري فوقاني تأثير مي‌گذارد به آن پيلونفريت (عفونت کليه) گفته مي‌شود.

فصل دوم
مروري بر تحقيقات انجام شده
2-1- بررسي تحقيق هاي انجام شده:
1. Versalovic et al (1991) روشهاي تعيين اثر انگشت ژنوم باکتريها را بر اساس تکثير عناصر تکراري با استفاده از PCR ارائه نمودند. بر اساس اين دستاورد، عناصر تکراري DNA که به منظور تعيين اثر انگشت مورد استفاده قرار مي گيرند بر 3 نوع مي باشند(ورسالويک و همکاران، 1991).
2. Versalovic et al (1994)عناصر تکراري محافظت شده به طول 154 جفت باز به نام BOX، متشکل از 3 جزء boxA, boxB, boxC (ورسالويک و همکاران، 1994).
3. در سال 1999، PETER و همکاران طي يک پروژه تحقيقاتي، يک پروتوکل Multiplex PCR به منظور شناسايي همزمان شيگا توکسين 1 و 2 (stx1 , stx2)، اينتيمين (eaeA) و همولايزين (EHEC hlyA) ارائه نمودند. اين محققين با استفاده از اين روش اقدام به شناسايي سريع سويه هاي E.coli بيماريزا در انواع نمونه هاي محيطي و کلينيکي نمودند(پيتر و همکاران،1999).
4. در سال 1999، Sharma و همکاران و در سال 2006، Heijnen و همکاران توانستند با استفاده از غني سازي اوليه و متعاقباً شناسايي ژنهاي ويرولانس با استفاده از تکنيک real-time PCR، با سرعت و ويژگي بالا اقدام به شناسايي ان
واع سويه هاي انتروپاتوژن E.coli در نمونه هاي نمايند(چريف و همکاران، 2003).

5. در سال 2000، PASS و همکاران اقدام به پاتوتايپينگ و شناسايي 11 ژن ويرولانس E.coli اعم از LTI, LTIIa,، LTIIb، STI، STII، VT1، VT2,، VT2e, ، eaeA، Eagg و Einv پرداختند. اين محققين اعلام نمودند که مي توان با استناد به اين تکنيک، کليه سويه هاي انتروپاتوژن E.coli را از يکديگر تفکيک نمود (کمپبل و همکاران، 2001).
6. در سال 2000، در آمريکا مطالعه اي روي نمونه خون بيماران دچار اوروسپسيس نشان داد که traT يک ژن شايع در بيماران داراي نقص ايمني و افراد با سيستم ايمني کامل است(آندري و همکاران، 2008).
7. در سال 2001، Campbell و همکاران پروتوکل شناسايي سويه پاتوژن E.coli O157:H7 را در نمونه ها به صورت Multiplex PCR ارائه نمودند. اين محقيقن پروتکل پيشنهادي خود را که بر اساس شناسايي ژنهاي ويرولانس و ساختاري بود بسيار حساس و با ويژگي بالا معرفي کردند (توني و همکاران، 2006).
8. در سال 2003، Fode و همکاران وCebula و همکاران اقدام به شناسايي مستقيم سويه هاي پاتوژن (بالاخص انتروهموراژن) E.coli از نمونه هاي ادراري و نيز بررسي بيماريزايي آنها در بيماران پرداختند. به ادعاي اين محققين، روش ارائه شده مي تواند حساسيت و کارايي قابل قبولي در شناسايي مستقيم E.coli داشته باشد(فود و همکاران، 2003).
9. در سال 2006، Toni و همکاران با انجام چندين پروتوکل PCR (به صورت تک و مالتي پلکس)، 58 ژن ويرولانس E.coli را در نمونه هاي کلينيکي مورد شناسايي و ارزيابي قرار دادند. مطابق نتايج حاصل از اين تحقيق، راه انتقال سويه هاي پاتوژن E.coli به تعدادي از اين بيماران آلوده به عفونت هاي ادراري بوده است (توني و همکاران، 2006).
10. در سال 2007، Bekal و همکاران و در سال 2009، Bruant و همکاران با استفاده از تکنيک ريزآرايه اقدام به شناسايي ژنهاي ويرولانس پاتوتايپ هاي انتروپاتوژن E.coli نمودند (بکال و همکاران، 2007; برانت و همکاران، 2009).
11. در سال 2007،Lan و همکاران که در دانشگاه ميشيگان انجام شد، مشخص گرديد که فيمبريه نوع I به مقدار زيادي در طول عفونت دستگاه ادراري بيان مي گردد که اين بيان مي تواند منجر به کاهش حرکت در اين باکتري گردد و اين موضوع به عنوان يک عامل مهم در عفونت، به ويژه در 24 ساعت از زمان کلونيزاسيون در مثانه، تلقي مي گردد(لن و همکاران، 2009).

12. در سال2010،Pina و همکاران، توانستند با طراحي يک مالتي پلکس PCR، عامل عفوني موجود در نمونه هاي ادراري را شناسايي نمايند. حسب نتايج اين محققين مشخص شد که عامل عفوني E.coli سويه O157:H7 بوده است. ژنهايي که در اين تحقيق مورد شناسايي قرار گرفتند عبارت بودند از stx1، stx2، wzyO157 و . eae.
13. در سال 2011، Oliviera و همکاران در برزيل توانستند با طراحي يک مالتي پلکس PCR، عامل عفوني موجود در نمونه هاي ادراري را شناسايي نمايند(بلنکو و همکاران، 2003).
14. در سال 2012،Kudinha و همکاران در استراليا با روش multiplex

مقاله رایگان درمورد زنان باردار، اقتصاد کشور

مشخص مي شود. در حالي که پيلونفريت، قسمت هاي بالاتر مجاري ادراري (کليه ها و لگنچه )را درگير مي کند و ممکن است آرام يا با تهوع و استفراغ همراه با سپسيس رخ دهد.23

1-8-1-4- سپتي سمي
هنگامي که دفاع طبيعي بدن ميزبان ضعيف است اشرشيا کلي به خون وارد شده و باعث سپتي سمي مي شود. اشرشيا کلي ممکن است باعث آرتريت چرکي، آبسه هاي پيش کليوي، اندوکارويت، استئوميليت، سينوزيت، آبسه هاي مغزي، پنوموني و ساير عفونت ها شود.
1-8-2- عفونت هاي مجاري ادراري UTI))
عفونت دستگاه ادراري يا UTI))، به حضور پاتوژن هاي ميکروبي درون مجاري ادراري اطلاق مي شود و يکي از شايعترين عفونت ها در بيماران سرپايي و يا بستري در بيمارستان است. اشرشيا کلي از مهمترين عوامل اتيولوژي UTI در انسان و تقريباً در تمام سنين محسوب مي شود(اديب فر، 1383). اشرشيا کلي يوروپاتوژن (UPEC)1، بيشترين ارگانيسمي است که در عفونت هاي UTI يافت مي شود و عامل 80 درصد موارد UTI حاد دستگاه ادراري را تشکيل مي دهد (استرايتون، 1373). ساليانه حدود 150 ميليون نفر در دنيا به عفونت مجاري ادراري مبتلا مي شوند و بيش از 6 ميليون دلار هزينه بر اقتصاد کشور ها تحميل مي شود. فراواني عفونت مجاري ادراري در زنان بيشتر از مردان مي باشد به طوري که تقريباً نيمي از خانم ها حداقل يکبار در طول عمر خود، عفونت مجاري ادراري را تجربه کرده اند. مهمترين فاکتور تعيين کننده ي بيماري زايي سويه هاي UPEC توانايي اتصال آن ها به سلول هاي اپي تليال روده از طريق ادهسين ها هست. فيمبريه هاي P مهمترين فاکتور ويرولانس اين باکتري ها هستند. علاوه بر اين، سويه هاي UPEC همچنين مي توانند مولکول هاي چسبندگي غير فيمبريه اي مانند Dr, AFA I, AFAII را نيز بيان کنند که همگي آنها به وسيله ژن هاي کروموزومي بيان مي شوند. UPEC همچنين توکسين هاي Sat 2Cft I, 3 و هموليزين را توليد مي کند(اديب فر، 1383). باکتري ها معمولاً از سه طريق ممکن است به دستگاه ادراري وارد شوند که شامل : عفونت بالارونده، انتشار خوني و انتشار لنفاتيک مي باشد. سويه هاي يوروپاتوژن اشرشيا کلي مي توانند از طريق مجراي ادراري بالا رفته و باعث ايجاد عفونت گردند (اديب فر، 1383; طباطبايي و فيروزي، 1384). عفونت مجاري ادراري معمولاً با عفونت مثانه شروع مي شود اما اغلب با فرا گرفتن کليه ها توسعه پيدا مي کند و سرانجام ممکن است منجر به نارسايي کليه ها و پيلونفريت شود و حتي ممکن است به خون هم راه يابد.24با توجه به افزايش خطر UTI در نوزادان، زنان باردار، افراد سالخورده، بيماران با آسيب هاي نخاعي، متعاقب استفاده از سوند ادراري، بيماران مبتلا به ديابت، مولتيپل اسکلروزيس و بيماران دچار نقص ايمني درمان اوليه و کنترل بيماري داراي اهميت خاصي است.
(تاج بخش، 1380; واکر، 1386). در عفونت هاي ادراري، انتخاب يک آنتي بيوتيک مناسب با کارايي و اثر بخشي بالا مي باشد امروزه مسئله ي مقاومت هاي آنتي بيوتيکي در ميان باکتري هاي پاتوژن به خصوص اشرشيا کلي به يک مشکل جدي تبديل شده است (جاکليک و آموس، 1387).
1-8-2-1- مقاومت هاي آنتي بيوتيکي
باکتري اشرشيا کلي به عنوان يک باسيل بي هوازي اختياري فلور نرمال روده انسان و حيوانات است اکثر عفونت هاي ناشي از اين باکتري در انسان به صورت فرصت طلب مي باشد. اخيراً مقاومت دارويي اشرشيا کلي به چندين آنتي بيوتيک از دسته هاي دارويي مختلف مورد توجه قرار گرفته است. بتالاکتام ها بيشترين آنتي بيوتيک هاي مصرفي در درمان عفونت هاي باکتريايي مي باشند. استفاده گسترده از اين آنتي بيوتيک ها در باکتري هاي بيماري زا منجر به توليد و جهش ديناميک و مداوم بتالاکتاماز ها در اين باکتري ها و افزايش طيف فعاليت آن ها در برابر آنتي بيوتيک هاي جديد شده است(بلانکو و همکاران، 11998; بوش و جاکوبي، 21997; هوتون، 2012)3. ژن هاي blaTEM و blaSHV از مهمترين اپرن هاي کد کننده بتالاکتاماز ها هستندکه محدوده طيف اثر وسيعي بر روي پني سيلين ها و سفالوسپورين ها دارند. اين بتالاکتاماز ها بر روي پلاسميد ها حمل مي شوند، ژن TEM-1 اولين و رايج ترين بتالاکتاماز پلاسميدي است که در سال 1960 مشخص گرديد، اين آنزيم سبب مقاومت به پني سيلين و سفالوسپورين هاي اوليه نظير سفالوتين و سفالوريدين مي گردد. اشرشيا کلي به دليل اکتساب پلاسميدهايي که توليد بتالاکتاماز وسيع الطيف ESBLs را کد مي کند، به تعدادي از آنتي بيوتيک ها از جمله سفالوسپورين هاي وسيع الطيف مقاوم شده است، از اين رو درمان عفونت هاي ناشي از اين باکتري علي رغم آسان بودن تشخيص آزمايشگاهي آن با شکست روبرو مي شود. ExPEC در سال 2000 به عنوان باکتري که در ايجاد مقاومت هاي آنتي بيوتيکي به خصوص در برابر سفالوسپورين ها و فلوروکينولون ها مهمترين نقش را دارد، معرفي شد. با توجه به اهميت شيوع بالاي اشرشيا کلي در عفونت هاي گوارشي و ادراري و همچنين بروز مقاومت آنتي بيوتيکي در گروه آنزيم هاي بتالاکتاماز وسيع الطيف که يکي از معضلات بهداشتي در سراسر دنيا و کشورمان طي ساليان اخير مي باشد.
ضرورت دارد که مقاومت هاي آنتي بيوتيکي بر روي عوامل بيماري هاي عفوني شناخته شود(پيت آئوت، 2012)4.25

1-8-2-2- مقاومت در اشرشيا کلي
درمان عفونت هاي گوارشي و خارج گوارشي اشرشيا کلي، با ظهور مقاومت هاي آنتي بيوتيکي در اواخر سال 1940 پيچيده تر شد. ظهور مقاومت در برابر سفالوسپورين ها، فلوروکينولون ها و تري متوپريم- سولفامتوکسازول، که اغلب جهت درمان عفونت هاي عمومي و بيمارستاني
اشرشيا کلي استفاده مي شد، درمان موثر اين بيماري ها را به تاخير انداخت و متعاقباً منجر به افزايش واگيري و مرگ و مير بيماران در اثر اين عفونت ها گرديد. تا سال 1990، سويه هاي، اشرشيا کلي به آنتي بيوتيک هاي نسل اول حساس بودند تا وقتي که چندين مطالعه در سال 2000 در سطح اروپا و آمريکا ي شمالي و جنوبي افزايش 20تا 45 درصدي مقاومت به آنتي بيوتيک هاي نسل اول را در ميان سويه هاي اشرشيا کلي را نشان داد. در اشرشيا کلي ايجاد مقاومت هاي چندگانه ي آنتي بيوتيکي مي تواند در اثر کسب پلاسميدهاي مقاومت رخ دهد. مکان اين مقاومت ها بر روي کروموزوم اشرشيا کلي با نام marA1 معين مي شود که پمپ جريان acr AB و ديگر ژن ها را بيان مي کند و منجر به مقاومت به طيف وسيعي از آنتي بيوتيک ها شامل تتراسايکلين، کلرامفنيکل، ?-لاکتام ها و ناليديکسيک اسيد مي گردد.
مقاومت به آنتي بيوتيک هاي ?- لاکتام در اين باکتري، در بيشتر موارد ناشي از توليد انواع مختلف آنزيم هاي بتالاکتامازي مي باشد که قادر به غير فعال سازي سفالوسپورين هاي نسل هاي جديدترهستند. بتالاکتامازهاي با طيف وسيع ESBLs به دنبال يک موتاسيون در آنزيم هاي اجدادي blaTEM و blaSHV ايجاد مي شوند و غالباً وابسطه به پلاسميد هستند. اخيراً بتالاکتاماز جديدي به نام CTX-M به طور اختصاصي در سويه هاي اشرشيا کلي شناسايي شد و باعث ايجاد مقاومت به طيف خاصي از آنتي بيوتيک ها در اين باکتري گرديد. انتشار ESBLs ها در ورود مقاومت هايي با طيف وسيع در ميان جمعيت هاي اشرشيا کلي به عنوان مشکل باليني بسيار مهم مطرح شده و باعث نگراني درمان عفونت هاي ناشي از اين باکتري گرديده است از سوي ديگر اشرشيا کلي به راحتي پلاسميدهاي R2 را به باکتري هاي روده اي ديگر مانند کلبسيلا، شيگلا، سالمونلا و انتروباکتر منتقل مي کند(جانسون و همکاران، 2005; پيت آئوت و همکاران، 2009; اسليمن، 2000).26
1-8-2-3- فيلوژنتيک اشرشيا کلي
فيلوتايپينگ و آناليز فيلوژني جدايه هاي اشرشيا کلي روشي جهت تعيين سير تکاملي و قابليت بيماري زايي اين باکتري است. بررسي هاي انجام شده بر روي سير تکاملي و تغييرات ژنتيکي اشرشيا کلي نشان مي دهد اين باکتري از نظر ساختار ژنتيکي به ميزان کمي در معرض تغييرات ناشي از نوترکيبي ژنتيکي است اين ويژگي اشرشيا کلي باعث شده است که در بررسي پلي مورفيسم داخل گونه اي کاربرد فراوان پيدا کند. برخي از محققين اعتقاد دارند که سويه هاي بيماري زاي اين باکتري از سويه هاي فرصت طلب منشاء گرفته اند. بدين معني که اين باکتري ها به دنبال موتاسيون و يا با اکتساب اپرن هاي حدت کروموزومي و يا پلاسميدي قابليت بيماري زايي را بدست مي آورند، که نتيجه آن حضور کلون هاي مختلف بيماري زا در جمعيت هاي اشرشيا کلي است.
در ارزيابي تکامل ژنتيکي اشرشيا کلي، بررسي هاي فيلوژنتيکي از اهميت خاصي برخوردار است که با روش هاي PCR، مولتي لوکوس آنزيم الکتروفورزيس1و ريبوتايپينگ2 صورت مي گيرد. شناسايي گروه فيلوژني سويه هاي اشرشيا کلي به روش PCR، به واسطه تعيين حضور ژن هاي chuA, yjaA و همچنين قطعه اي از DNA تحت عنوان TSPE4.C2 امکان پذير مي گردد. ارتباط فيلوژنتيکي سويه هاي ECOR (مجموعه سويه هاي رفرانس اشرشيا کلي)3 نشان مي دهد که سويه هاي اشرشيا کلي در چهار گروه اصلي فيلوژنيA, B1,B2, D قرار مي گيرند. به طور کلي به منظور افزايش دقت گروه بندي فيلوژني و بر اساس حضور يا عدم حضور ژن هاي chuA, yjaA و قطعه TSPE4.C2 هفت گروه و تحت گروه فيلوژني در سويه هاي اشرشيا کلي تعريف شده است :(A1, A2, B11, B21, B22, D1, D2 ).
سويه هاي فيلوژنتيکي همچنين از نظر اندازه ژنوم با يکديگر تفاوت دارند به طوري که ژنوم سويه هاي موجود در گروه هاي فيلوژنتيکي A, B1 نسبت به ژنوم سويه هاي موجود در گروه فيلوژنتيکي B2, D کوچکتر مي باشد. بررسي هاي فيلوژنتيکي بر روي سويه هاي اشرشيا کلي مولد بيماري هاي خارج گوارشي در انسان نشان مي دهد که آن ها عمدتاً متعلق به گروه B2 بوده و تعداد کمي از آن ها در گروهD قرار مي گيرند اين سويه ها از نظر حضور ژن هاي وابسطه به حدت از سويه هاي فرصت طلب انساني متفاوتند(موري، 1389; ديوريز و همکاران، 2001; اسکوبار و همکاران، 2006).5،427

1-9- عوامل بيماري زايي (ويرولانس در اشرشيا):
تجزيه و تحليل توالي ژنوم بيانگر اين است که ژن هاي ويرولانس در پاتوژن ها، تا حدودي متفاوت از ساير ژن ها در کروموزوم مي باشد. اين تفاوت ها شامل محتواي نوکلئوتيدها، درصد GC، ارتباط ژن هاي ويرولانس با عناصر متحرک ژنتيکي مانند (توان الحاقي، ترانسپوزون ها، اينتگرون ها، پلاسميد ها) مي باشد (گارمنديا و همکاران، 2005)6.
توانايي يک ارگانيسم براي ايجاد عفونت نه تنها به حساسيت ميزبان در مقابل تهاجم ميکروارگانيسم بستگي دارد، بلکه به ويژگي بيماريزايي ارگانيسم نيز مربوط مي شود. يک ارگانيسم براي ايجاد عفونت بايد داراي فاکتورهايي باشد که اجازه ورود به ميزبان و بيماريزايي را پيدا کند. سويه هاي بيماري زا و غير بيماري زا اشريشياکلي در خصوصيات بيوشيميايي و حساسيت دارويي مشابه اند. توانايي UPEC براي ايجاد عفونت علائم دار دستگاه ادراري به دليل وجود دو نوع عامل ويرولانس مي باشد: ادهسين ها ( مثل فيمبريه نوع I، P-فيمبريه، S-فيمبريه، FIC-فيمبريه و…) و توکسين ها (مثل هموليزين، فاکتور نکروزدهنده تومور) (ناظمي و همکاران، 2010 ). اتصال به اپي تليوم دستگاه ادراري اولين مرحله UTI مي باشد و اين باعث مي شود تا باکتري نسبت به نيروهاي هيدروديناميک جريان ادرار مقاوم باشد (بهراني و همکاران 2002) و اين موضوع باعث
افزايش يافتن توانايي آن ها براي تکثير و تهاجم به بافت کليوي مي گردد (جدول شماره1-1) (تيبا و همکاران، 2008)1.
1-9-1-ژن aer (آئروباکتين):
مولکول هاي متصل به آهن مانند آئروباکتين و آنتروباکتين به وسيله ي برخي از سويه هاي بيماري زايي اشرشيا کلي، سنتز مي گردند. زماني که ميزان آهن در دسترس بافتي پايين باشد، اين مولکول ها با اتصال به آهن موجبات ادامه ي حيات باکتري را فراهم مي نمايند. باکتري ها به واسطه توليد ترکيبات ترشح کننده آهن مانند آئروباکتين با پروتئين هاي ترشح کننده آهن موجود در بدن رقابت کرده و آهن را از آنها مي گيرد.

1-9-1-1- ژن آلفا هموليزين (hlyA) و سايتوتوکسيک نکروزيتينگ فاکتور1 (CNF1):
هموليزين ها، سموم مقاوم و حساس به گرما، فعاليت متابوليک، المنت هاي ژنتيکي، پلاسميدها، عموماً با تهاجم ارتباط دارد. توکسين هايي هستند که باعث آسيب بافتي مي شوند که انتشار باکتري و ترشح مواد غذايي ميزبان را تسهيل مي کند و ممکن است همچنين باعث تغيير مسير هاي انتقال پيام در ميزبان شود.28

1-9-1-2- اتصال دهنده ها (Adhesions):
از ديگر عوامل تهاجم اتصال دهنده ها مي باشند که ممکن است فيمبريه اي يا غير فيمبريه اي باشد. فيمبريه (پيلي) رشته ايي از جنس پروتئين است و بصورت پليمري از زير واحدها در سطح باکتري تشکيل مي شود. نقش اصلي آن ها در اتصال مي باشد و بطور مستقيم در بيماريزايي سويه هاي اشريشياکلي تاثير دارد. پيلي مي توان به عنوان گيرنده باکتريوفاژ نيز عمل کند و در جذب و انتقال DNA و همچنين تحرک باکتري ايفاي نقش مي کند. فيمبريه نوع I (نه فيمبريه نوع P) در خلال کلونيزه شدن ابتدائي سلول هاي اپيتليال بيان شده در حاليکه فيمبريه P بعداً هنگامي که باکتري در قسمت تحتاني دستگاه تنفس يا بافت هاي بدن است، بيان مي شود. باکتري ها هنگامي که فيمبريه نوع يک را بيان مي کنند سريعاً به وسيلة ماکروفاژها کشته مي شوند. انواعي از پيلي که در استقرار و بيماريزايي سويه هاي مختلف E.coli نقش دارند که شامل پيلي تيپ ?، پيلي نوع P، پيلي نوع S، پيلي CS1 و پيلي تيپ 4 مي شوند. پيلي تيپ ? به گيرنده هاي گليکوپروتئيني که حاوي مانور، که در سطح RBC و سلول هاي يوکاريوتي يافت مي شوند متصل مي شوند. پلي نوع P با سلول هاي کليه و مجاري ادراي ارتباط برقرار مي کنند و نقش مهمي در ايجاد بيماري يوروپاتوژن (عفونت مجاري ادراي) دارند. پيلي نوع S در سويه هاي که باعث مننژيت در نوزادان مي شود ديده مي شوند. پيلي CS1 موجب استقرار سويه هاي ETEC در روده مي شوند(توت و همکاران، 2001)1.
پيلي تيپ 4 که به دو کلاس 4A و 4B تقسيم مي شود. انواع 4B در بسياري از پاتوژن هاي روده ايي ديده مي شود مانند پيلي تشکيل دهنده تجمع يا BFP (Bundle-forming pili) که در EPEC در قطبين باکتري ايجاد مي شود يا CFA/? و لانگوس پيلي که در سويه ETEC وجود دارد(آماويزيت وهمکاران، 2001)2. يک اتصال دهنده بارز و غير فيمبريه اي پروتئين اينتمين (Intimin) مي باشد که به وسيله ژن eae (اتصال و جدايي اشريشياکلي) (Attaching and effacting) موجود در EHEC و EPEC توليد

مقاله رایگان درمورد اشرشيا، کلي، آنتي، باکتري

ا گرديد. باکتري اشرشيا کلي با استفاده از تکنيک هاي بيوشيميايي و ميکروب شناسي استاندارد شناسايي شد. استخراج ژنوم باکتري ها با استفاده از روش جوشاندن انجام گرفت و بررسي وجود و تعيين هويت فاکتورهاي ويرولانس با استفاده از روش PCR انجام گرفت. نتايج: PCR به طور موفقيت آميزي براي تمامي 6 ژن مورد نظر بهينه سازي شد و توانست باندهاي مورد نظررا نشان دهند. عفونت مجاري ادراري ايجاد شده با اشرشيا کلي 83 % برآورد گرديد شيوع ژن هاي ويرولانس به ترتيب شامل:(98%)( bp 328) Pap(95%)(bp 602) aer ،(94%)( bp 559) Fim،(86%)( bp 693)cnf ،(63%)( bp 750)Afa ، (62%)( bp 1177)hlyA به طور موفقيت آميزي تکثير يافتند. بحث: مطالعه حاضر نشان داد که شيوع ژن هاي ويرولانس pap ،aer ، Fimدر ميان سويه هاي اشرشيا کلي يوروپاتوژن جدا شده از بيماران مراجعه کننده به بيمارستان بقيه الله (عج) تهران بالا مي باشد و کمترين شيوع مربوط به ژن hlyA (هموليزين)مي باشد.
کلمات کليدي: اشرشيا کلي يوروپاتوژن، عفونت مجاري ادراري، ژن هاي ويرولانس، واکنش زنجيره اي پليمراز
فصل اول
مقدمه
1-1-بيان مسئله
اشريشيا کلي(E.coli)1 يک باسيل گرم منفي از خانواده انتروباکترياسه است که به طور شايع در روده جانوران خونگرم و برخي پرندگان وجود دارد. انتقال اين باکتري از طريق مسير مدفوعي- دهاني از يک فرد به فرد ديگر و يا از طريق آب و غذاي آلوده مي باشد. اشريشيا کلي به خوبي روي محيط هاي معمولي رشد کرده و يک باکتري کم نياز است و در روي محيط هاي جدا کننده روده اي بيشتر سويه ها کلني هاي تخمير کننده لاکتوز را ايجاد مي کنند (هاملين و همکاران،2007)2. اشرشيا کلي يکي از مهمترين دلايل ايجاد کننده عفونت هاي کليه، مثانه، ريه و مننژ مي باشند که به نوبه خود ممکن است منجر به سپسيس گردند و يکي از مهمترين عوامل تهديد کننده حيات انسان محسوب مي شوند (چانج و همکاران، 2006 )3. عفونت مجاري ادراري(UTI)4 يکي از شايع ترين عفونت هاي باکتريايي در انسان است که به طور عمده توسط اشرشيا کلي ايجاد مي شود(گريبلينگ و توماس، 2005)5. عفونت هاي ادراري از لحاظ شيوع، رتبه دوم را پس از عفونت هاي تنفسي داشته و در بزرگسالان رتبه اول بيماري هاي عفوني بزرگسالان را از نظر مراجعه به پزشک تشکيل مي دهند. به اين ترتيب اهميت عفونت هاي ادراري از نظر عوارض بسيار جدي که در نتيجه عدم تشخيص درمان مناسب بر جاي مي گذارد بر کسي پوشيده نيست در ارزيابي تکامل ژنتيکي اشرشيا کلي، بررسي هاي فيلوژنتيکي از اهميت خاصي برخوردار است. اشرشيا کلي عامل 90-80 درصد از عفونت مجاري ادراري اکتسابي از جامعه و 50-30 درصد از عفونت مجاري ادراري بيمارستاني است(نعمتي و همکاران، 2014).
1
2 عفونت مجاري ادراري از علل عمده بستري شدن در بيمارستان با عوارض قابل توجه و هزينه هاي مراقبت بهداشتي است(نعمتي و همکاران، 2014 ). تشخيص و درمان موثر عفونت مجاري ادراري يک نگراني بزرگ در زمينه ي مراقبت هاي بهداشتي است(سنتيلو و فرانکلين، 2007)1. در سراسر جهان حدود 150 ميليون نفر با عفونت مجاري ادراري تشخيص داده شده اند که هر ساله هزينه اقتصادي در اين زمينه بيش از 6 ميليارد دلار در جهان مي باشد (کومار و همکاران، 2006)2. شدت عفونت مجاري ادراري به دو عامل ويرولانس باکتري و حساسيت ميزبان بستگي دارد(گريبلينگ و توماس، 2005). اشرشيا کلي ايجاد کننده ي عفونت مجاري ادراري UPEC))3 فاکتورهاي ويرولانس مختلفي از جمله آلفا هموليزين، فاکتور نکروز دهنده سايتوتوکسيک، چسبنده ها و سيستم هاي اکتساب آهن دارد; اين فاکتورها در نهايت منجر به آسيب بافتي مي شوند(پيت آئوت، 2012)4. اتصال باکتري به سلول هاي اورو اپي تليال يک مرحله ضروري براي شروع و گسترش است. اين فرايند به باکتري اجازه مي دهند تا در مقابل عملکرد شستشوي ادرار و تخليه مثانه و فعال شدن مسيرهاي انتقال پيام در ميزبان مقاومت کند. سويه هاي اشرشيا کلي يوروپاتوژن قادر هستند تا انواع متفاوتي از چسبنده هاي لازم براي تشخيص و اتصال به رسپتورهاي مجاري ادراري را توليد کنند: از جمله فيمبريه تيپ 1 که توسط ژن fim کد مي شود، P فيمبريه که توسط ژن هاي pap (phylonephritis-associated pili) کد مي شود، S فيمبريه که توسط ژن هاي sfa کد مي شود و چسبنده ي Afa که توسط ژن هاي afa کد مي شود(آنتااو و همکاران، 2009)5. توليد توکسين ها مانند هموليزين و سايتوتوکسيک نکروز دهنده فاکتور 1(CNF1 ( باعث آسيب بافتي مي شود که انتشار باکتري و ترشح مواد غذايي ميزبان را تسهيل مي کنند و ممکن است همچنين باعث تغيير مسيرهاي انتقال پيام در ميزبان شود(توماس و همکاران، 2011)6. از ديگر خصوصيات UPEC براي ايجاد عفونت مجاري ادراري سيستم اکتساب آهن است که باکتري با کمک سيدروفورها آهن را از محيط جذب مي کند. ژن aer سيدروفور آئروباکتين را کد مي کند (نعمتي و همکاران، 2014).
1-2- اهميت و ضرورت تحقيق
تحقيق فوق از آن جهت حائز اهميت نو آوري است که تاکنون در خصوص شناسايي ژن هاي پاتوژنيسته و ويرولوتيينگ ايزوله هاي جداشده از منابع يوروپاتوژن عفونت هاي ادراري اشرشيا کلي تحقيقي جامع در برخي بيمارستان ها از جمله بيمارستان بقيه الله (عج) تهران انجام نشده است و ما قصد داريم اين تحقيق را براي اولين بار در اين بيمارستان به انجام برسانيم.

1-3-اهداف تحقيق:

اهداف علمي:
1. تعيين فراواني ژن هاي مرتبط با بيماري زايي سويه هاي اشرشيا کلي يوروپاتوژن جداشده از بيماران مراجعه کننده به بيمارستان بقيه الله(عج) تهران.
2. تعيين ويرولوتيپ هاي سويه هاي اشرشيا کلي جدا شده از بيماران بيمارستان
بقيه الله (عج) تهران.
3. تعيين رابطه ي بين ژن هاي پاتوژنيسته خاص با سويه هاي جدا شده از اشرشيا کلي يوروپاتوژن از بيماران بيمارستان بقيه الله (عج) تهران.

اهداف کاربردي:
راه اندازي روش هاي سريع شناسايي ژن هاي پاتوژنيسته و تعيين ويرولوتيپ هاي سويه ها

1-4- فرضيه هاي تحقيق:
1. سويه هاي اشرشيا کلي يوروپاتوژن جدا شده از عفونت هاي ادراري داراي ژن هاي ويرولانس خاصي مي باشند.
2. انتظار مي رود فراواني ژن هاي ويرولانس باکتري اشرشيا کلي در ايران همانند کشورهاي ديگر باشد.
3. بين حضور ژن هاي خاص ويرولانس و منبع جداسازي باکتري ها رابطه وجود دارد.

1-5- تاريخچه
اشرشيا کلي اولين بار به وسيله پزشکي آلماني به نام تئودر اشريش1شناسايي شد. او در سال 1885، اين ارگانيسم را باکتريوم کلي 2 ناميد و آن را به عنوان عامل بيماري زاي اصلي عفونت هاي روده اي و برخي از عفونت هاي خارج روده اي معرفي کرد. نام باکتريوم کلي به طور وسيع تا سال 1919 استفاده مي شد تا وقتي که کاستلائي 3 و کالمرز4جنس اشرشيا را تعريف کردند و نام اشرشيا کلي را پايه نهادند. 3
اشرشيا کلي4ارگانيسمي است که به شدت از جنبه هاي مختلف مورد مطالعه قرار گرفته است. در باکتريولوژي عمومي به عنوان ارگانيسم مدل براي مطالعه ي ساختار سلولي، رشد ومتابوليسم استفاده مي شود، همچنين ابزاري بسيار مهم براي کلونينگ ژن ها در سلول هاي پروکاريوتي و يوکاريوتي و بيان محصولات ژن ها شده است. اشرشيا کلي به عنوان ارگانيسم کنترلي جهت انجام آزمايشهاي کنترلي موثر بودن عوامل ضد ميکروبي و مواد ضد عفوني کننده استفاده مي شود و به عنوان ارگانيسم انديکاتور جهت تعيين آلودگي مدفوعي، مواد غذايي، آب و محيط مطرح مي باشد و نقش مهمي را به عنوان فلور ميکروبي روده ي انسان و حيوانات خونگرم تشکيل مي دهد. کم و بيش برخي از سويه هاي پاتوژن هاي مهمي براي ميزبان هايشان هستند.

1-5-1- خانواده انتروباکترياسه
خانواده انتروباکترياسه بزرگترين و ناهمگون ترين مجموعه ي باسيل هاي گرم منفي هستند که از لحاظ باليني اهميت دارند. حداقل 28 جنس و 7 گروه روده اي5 با بيش از 80 سويه شناخته شده است. جنس هاي اين خانواده بر اساس خصوصيات بيوشيميايي، ساختار آنتي ژني و ترادف يابي اسيدهاي نوکلئيک طبقه بندي شده اند. باکتري هاي متعلق به انتروباکترياسه گسترش جهاني داشته و ساکن روده ي حيوانات و انسان ها هستند و گياهان، خاک و آب را آلوده مي سازند. آن ها بسياري از بيماري هاي باليني از قبيل آبسه، پنوموني6، مننزيت، سپتي سمي و عفونت هاي اداري را باعث مي شوند(عموئيان و ميبدي، 1383). باکتري هاي خانواده انتروباکترياسه را به دو دسته باکتري هاي فرصت طلب و بيماري زاي روده اي تقسيم مي کنند که برخي از جنس هاي اين خانواده مثل سالمونلا، شيگلا و يرسينا هميشه مرتبط با بيماري هستند و جز پاتوژن هاي روده اي مي باشند ولي برخي ديگر مانند اشرشيا کلي، کلبسيلا و پروتئوس به عنوان فلور طبيعي روده بوده و با ايجاد شدن شرايطي مانند کسب ژن هاي بيماري زايي از طريق پلاسميد و باکتريوفاژ، به هم خوردگي فلور ميکروبي، جابجايي فلور ميکروبي و غيره، قدرت بيماري زايي را به دست آورده و سبب ايجاد عفونت هاي فرصت طلب مي شوند.5
1-5-2- اشرشيا کلي
اشرشيا کلي شايع ترين و مهمترين جنس در خانواده انتروباکترياسه مي باشد که در پزشکي اهميت دارد. اشرشيا کلي باکتري بي هوازي اختياري و بخشي از فلور فيزيولوژي روده اي در انسان و حيوانات خونگرم است اما برخي از سويه ها سبب بيماري هايي مثل پنوموني، گاستروانتريت1، بيماري هاي ادراري -تناسلي و سپتي سمي مي شوند. چندين واريانت پاتوژن اجباري و اختياري از اشرشيا کلي وجود دارد که باعث انواع مختلفي از عفونت هاي روده اي و خارج روده اي در انسان و حيوانات مي شود. در سال هاي اخير سويه O157:H7 اشرشيا کلي به عنوان پاتوژن مهم مشترک بين انسان و دام مطرح گرديده، که از طريق غذا منتقل مي شود. اين سويه عامل سندرم اورمي هموليتيک -کوليت خونريزي دهنده 2 در انسان است (عادلي، 1386).

1-5-3- طبقه بندي
براي اولين بار دسته بندي اشرشيا کلي بر اساس تيپ هاي متنوعي از آنتي ژن سوماتيک O توسط کائوفمن3 انجام گرفت. برخي محققين چندين گونه براي آن قائل اند : اشرشيا هرماني4، اشرشيا دکربوکسيلاتا5، اشرشيا ولنزي6، اشرشيا فرگوسني7، اشرشيا کلي و اشرشيا بلاته8، که بين اين ها گونه اخير از موارد انساني جدا نشده است. در کتاب Bergeys Manual که در سال 1984 چاپ شد، بر اساس يافته هاي DNA در خانواده انتروباکترياسه 20 جنس قرار گرفت (رحيمي، 1387 ).6
* طبقه بندي اشرشيا کلي بر دو اساس صورت مي گيرد:
1. بر اساس ساختار آنتي ژني
2. بر اساس Colicin typing (شناسايي کلي سين ها)

1-5-3-1- ساختار آنتي ژني اشرشيا کلي
آنتي ژن هاي سطحي در اشرشيا کلي را مي توان به وسيله آزمايش هماگلوتيناسيون نشان داد: سه نوع آنتي ژن سطحي بطور گسترده براي تعيين سروتيپ ارگانيسم هاي انتريک استفاده مي شوند که شامل آنتي ژن هاي سوماتيک 1 (آنتي ژن (O، آنتي ژن کپسولي ( آنتي ژن K ) و آنتي ژن تاژکي ( آنتي ژن H ) مي باشند(تصوير شماره1-1). آنتي ژنF يا فيمبريه اي، نيز جزء آنتي ژن هاي سطحي است که در برخي از سروتيپ ها يافت مي شود.

1-5-3-2- ساختار آنتي ژن سوماتيک يا آنتي ژن O
آنتي ژن سطحي O، بخشي از ليپو پلي ساکاريد 2 يا LPS جدار باکتري است. LPS، مجتمع گليکوليپيدي جدار باکتري هاي گرم منفي است و از سه ساختار مشخص
تشکيل شده است :
الف- هسته مرکزي پلي ساکاريدي، که يک قند 8 کربني به نام کتودزاکسي اوکتونات است و به آنتي ژن اختصاصيO متصل مي شود.
ب- ليپيد A که به هسته مرکزي متصل مي شود و بروز تاثيرات بيولوژيکLPS باکتري هاي گرم منفي ناشي از اين بخش از باکتري است و درواقع اندوتوکسين باکتري محسوب مي شود. ليپيد A مي تواند باعث تب، لوکوپني و حتي نهايتاً مرگ شود.
ج – آنتي ژن اختصاصي O، که پليمري از واحد هاي تکراري اليگوساکاريدي است و به خاطر تفاوت آن در سويه هاي مختلف، در تعيين سروتيپ حائز اهميت است.
به نظر مي رسد طول زنجيره جانبي اختصاصي Oو انتشار آن در سطح باکتري در مقاومت نسبت به کمپلمان نقش داشته باشد، يعني سويه هايي که بيش از 20 درصد از زنجيره هاي مولکولي LPS آن ها طويل هستند نسبت به تاثير سرم مقاومند، در حالي که سويه هايي که کمتر از 20 درصد زنجيره هاي مولکولي LPS آن ها طويل باشد، نسبت به سرم حساس هستند. بر همين اساس، اخيراً آنتي بيوتيک هايي طراحي شده است که با بيوسنتز پلي ساکاريد مرکزي LPS تداخل مي کنند.7
همچنين بيان شده که در بين باکتري هاي روده اي، اجرامي که آنتي ژن هاي سوماتيک آن ها داراي گروه هاي فوق العاده هيدروفوبيک 3 ( قندهاي دي دزاکسي ) باشند، بيماري زا تر هستند. آنتي ژن هاي O مقاوم به حرارت هستند و در دماي 100 درجه سانتي گراد براي 5/2 ساعت هم غير فعال نمي شوند (کويين و همکاران، 1386)4.
آنتي ژن O در تنوع آنتي ژني شرکت دارد و باعث القاء پاسخ هاي سيستم ايمني ميزبان مي شود. غربالگري سروگروه هاي سوماتيک اشرشيا کلي يک روش متداول در شناسايي اشرشيا کلي است. به طوري که براساس آنتي ژن O اشرشيا کلي 14 سروتيپ را ايجاد مي کند که شامل O1, O2, O4, O6, O7, O8, O15, O16,O18, O21, O22, O25, O75, O85 مي باشند. آنتي ژن سوماتيک به عنوان آنتي ژن اختصاصي در هر جنس مطرح مي باشد، اما واکنش متقاطع بين جنس هاي بسيار نزديک (سالمونلا با سيتروباکتر1 و اشرشياکلي با شيگلا) شايع مي باشد (موري، 1389; بران و همکاران، 2002)2.
1-5-3-3- ساختار آنتي ژن کپسولي يا آنتي ژن k
اين آنتي ژن در اکثر جنس هاي خانواده انتروباکترياسه به صورت يک لايه چسبنده همگن اطراف باکتري را فرا گرفته و روي آنتي ژن O قرار دارد و نسبت به حرارت حساس است و به طور معمول براي تيپ بندي سويه ها استفاده نمي شود، اما از اين جهت اهميت دارد که ممکن است در تشخيص آنتي ژن O اختلال ايجاد کند پادگن کپسولي k که گاهي به آن پادگن پوششي هم مي گويند، روي پادگن هاي O قرار گرفته و مانع آگلوتيناسيون 3 آن با آنتي سرمO 4 مي شوند. با جوشاندن سوسپانسيون ارگانيسم به منظور از بين بردن آنتي ژن K (که حساس به حرارت است ) و باقي ماندن آنتي ژن O (مقاوم به حرارت ) در حرارت زياد مي توان بر اين مشکل فايق آمد(کويا، 1998). ماهيت اين گروه پادگني پلي ساکاريدي بوده که با حرارت دادن، تغيير يافته و در نتيجه آگلوتيناسيون بين آنها رخ مي دهد. در طي تحقيقات اخير مشخص شده است که پادگن هاي K در سويه هاي خاصي از اشرشيا کلي ماهيت پروتئيني دارد. فيمبريه هاي K99 و K88 جدا شده از حيوانات و پادگن هاي عوامل سيطره اي جدا شده از

مقاله رایگان درمورد نتايج، دمايي، اشرشيا، ويرولانس

اشرشيا کلي يوروپاتوژن……………………………………………………70
4-6-6-1- بهينه سازي دماي اتصال………………………………………………………………………………………………………………………………………………………………….70
4-7-ژن هاي ويرولانس…………………………………………………………………………………………………………………………………………………………………………………………72
4-8-نتايج ويرولوتايپينگ سويه ها………………………………………………………………………………………………………………………………………………………………………77
4-9-نتايج تاييد محصولات PCR ………………………………………………………………………………………………………………………………………………………………………79
فصل پنجم: نتيجه گيري
5-1-بحث………………………………………………………………………………………………………………………………………………………………………………………………………………….91
5-2-مقايسه نتايج بدست آمده با يافته هاي ديگر محققين…………………………………………………………………………………………………………………………..91

عنوان صفحه
5-3-نتيجه گيري……………………………………………………………………………………………………………………………………………………………………………………………………….95
5-4- پيشنهادات………………………………………………………………………………………………………………………………………………………………………………………………………..95
فهرست منابع
منابع فارسي………………………………………………………………………………………………………………………………………………………………………………………………………………….96
منابع انگليسي………………………………………………………………………………………………………………………………………………………………………………………………………………97
چکيده انگليسي………………………………………………………………………………………………………………………………………………………………………………………………………..102زمون آ

فهرست جدول ها
عنوان جدول صفحه
جدول 1-1: ژن هاي ويرولانس در اشرشيا کلي و عملکرد ژن ها………………………………………………………………………………………………………………….30
جدول3-1: مشخصات پرايمرهاي مورد استفاده…………………………………………………………………………………………………………………………………………………..48
جدول 3-2: اجزاء و ترکيبات مورد استفاده براي واکنش PCR ……………………………………………………………………………………………………………………..49
جدول 3-3: برنامه دمايي ترموسايکلر براي ژن aer ………………………………………………………………………………………………………………………………………….50
جدول 3-4: برنامه دمايي ترموسايکلر براي ژن HlyA………………………………………………………………………………………………………………………………………51
جدول 3-5: برنامه دمايي ترموسايکلر براي ژن Pap ………………………………………………………………………………………………………………………………. 52
جدول 3-6: برنامه دمايي ترموسايکلر براي ژن Cnf ……………………………………………………………………………………………………………………………………..52 جدول 3-7: برنامه دمايي ترموسايکلر براي ژن Afa …………………………………………………………………………………………………………………………………………53
جدول 3-8: برنامه دمايي ترموسايکلر براي ژن Fim………………………………………………………………………………………………………………………………………..54
جدول 4-1: مشخصات ايزوله هاي اشرشيا کلي جدا شده از بيماران……………………………………………………………………………………………………………73
جدول 4-2: نتايج ويرولوتايپينگ درکل سويه ها…………………………………………………………………………………………………………………………………………………77
جدول4-3: نتايج ويرولوتايپينگ در سويه هاي اشرشيا کلي، سويه هاي مشابه در هر ژن……………………………………………………………………….78

فهرست علامت ها و اختصارها
معادل فارسي معادل انگليسي علامت

اشرشيا کلي Escherichia coli E.coli
واکنش زنجيره اي پليمراز PCR Polymerase chain reaction
عفونت مجاري ادراري Infectios UTI Urinary Tract
اشرشيا کلي يوروپاتوژن UPEC Uropathogenic Escherichia coli

فهرست شکل ها و تصوير ها
عنوان شکل صفحه
شکل1-1: شکل شماتيک از ساختار آنتي ژني اشرشيا کلي………………………………………………………………………………………………………………………………..10
شکل1-2: شکل شماتيک از نحوه اتصال باکتريE.coli به سطح سلول هاي اپيتليال سطحي بدن………………………………………………………..31
شکل1-3: شکل شماتيک از فاکتورهاي ويرولانس در اشرشيا کلي………………………………………………………………………………………………………………..33
شکل1-4: شکل شماتيک از مکانيسم بيماري زاييUPEC ……………………………………………………………………………………………………………………………….34
شکل 3-1: کميت سنجي
و غلظت سنجي DNA ……………………………………………………………………………………………………………………………………………….47
شکل 4-1: گراديانت دمايي جهت انتخاب دماي منايب براي ژن aer……………………………………………………………………………………………………………62
شکل4-1-1: نتايج PCR به منظور تکثير ژن aer در ساير ايزوله ها……………………………………………………………………………………………………………….63
شکل4-1-2: نتايج PCR ژن aer در ساير ايزوله ها……………………………………………………………………………………………………………………………………………63
شکل4-2: گراديانت دمايي جهت انتخاب دماي منايب براي ژن Cnf ………………………………………………………………………………………………………….64
شکل4-2-1: نتايج PCR ژن Cnf در ساير ايزوله ها………………………………………………………………………………………………………………………………………….65
شکل4-3: گراديانت دمايي جهت انتخاب دماي منايب براي ژن HlyA ……………………………………………………………………………………………………..66
شکل4-4: گراديانت دمايي جهت انتخاب دماي منايب براي ژنPap……………………………………………………………………………………………………………67
شکل4-4-1: نتايج PCR ژن Pap در ساير ايزوله ها…………………………………………………………………………………………………………………………………………68
شکل 4-5: گراديانت دمايي جهت انتخاب دماي منايب براي ژن Afa ……………………………………………………………………………………………………..69
شکل 4-5-1: نتايج PCR ژن Afa در ساير ايزوله ها……………………………………………………………………………………………………………………………………..70
شکل4-6: گراديانت دمايي جهت انتخاب دماي منايب براي ژن Fim………………………………………………………………………………………………………..71
شکل4-7: ژن هاي ويرولانس در کنار هم. …………………………………………………………………………………………………………………………………………………………72
شکل4-8-1: نتايج حاصل از سکانسينگ برخي محصولات PCR ژن ويرولانس aer…………………………………………………………………………..79
شکل4-8-2: نتايج حاصل از سکانسينگ برخي محصولات PCR ژن ويرولانس HlyA……………………………………………………………………..81

عنوان شکل صفحه
شکل4-8-3: نتايج حاصل از سکانسينگ برخي محصولات PCR ژن ويرولانس Cnf…………………………………………………………………………83
شکل4-8-4: نتايج حاصل از سکانسينگ برخي محصولات PCR ژن ويرولانس Afa …………………………………………………………………………86
شکل4-8-5: نتايج حاصل از سکانسينگ برخي محصولات PCR ژن ويرولانس Fim…………………………………………………………………………..88
شکل4-8-6: نتايج حاصل از سکانسينگ برخي محصولات PCR ژن ويرولانسPap…………………………………………………………………………….89

فهرست نمودار ها
عنوان نمودار صفحه

نمودار4-1: فراواني بيماران بر اساس جنس…………………………………………………………………………………………………………………………………………………..59
نمودار4-2: فراواني بيماران براساس سن (سال)…………………………………………………………………………………………………………………………………………..60
نمودار4-3: نتايج مربوط به فراواني فاکتورهاي حدت در اشرشيا کلي………………………………………………………………………………………………….61

چکيده
زمينه و هدف: اشرشيا کلي يوروپاتوژن يکي از مهمترين عوامل ايجاد کننده عفونت مجاري ادراري است. اين سويه ها انواع مختلفي از فاکتورهاي ويرولانس از جمله چسبنده ها، توکسين ها، سيستم هاي اکتساب آهن را دارا مي باشند. ژن هاي ويرولانس روي عناصر ژنتيکي متحرک و يا در نواحي خاصي از کروموزوم که جزاير پاتوژنيستي ناميده مي شوند قرار دارند. هدف از اين مطالعه بررسي وجود و تعيين هويت فاکتور هاي پاتوژنيسته در سويه هاي اشرشيا کلي يوروپاتوژن جدا شده از بيماران مراجعه کننده به بيمارستان بقيه الله(عج) تهران مي باشد. مواد و روش ها: از 150 نمونه ي ادرار جمع آوري شده از بيماران مراجعه کننده به بيمارستان بقيه الله (عج) تهران مجموعه اي از 100 ايزوله ي اشرشيا کلي بين تيرماه تا دي ماه 1393 جد