مقاله رایگان درمورد دمايي، دقيقه، دماي، پرايمر

دانلود پایان نامه

ن مي‌دهد. اين نسبت بايد بين 8/1 تا 2 باشد. اگر نسبت كوچك‌تر از 8/1 باشد، آلودگي DNA را با پروتئين يا فنل نشان مي‌دهد و نسبت بزرگتراز 2 به دليل وجود RNA در نمونه مي باشد.6

از تقسيم جذب نوري (OD) در طول موج 260 نانومتر به جذب نوري در طول موج 280 نانومتر ميزان خلوص نمونه ي DNA بدست آمد به اين صورت که با از دستگاه NANO DROP که متصل به کامپيوتر مي باشد ابتدا مقدار کمي در حد يک حباب آب مقطر ريخته و سپس Blank را زده تا دستگاه آماده اندازه گيري شود و سپس مقدار 1? از ژنوم را در جايگاه مورد نظر ريخته و سپس با زدن کليد Measure عمل محاسبه انجام مي گيرد و تصويري همراه با نمودار از ژنوم روي صفحه کامپيوتر حاصل مي شود (تصوير شماره3-1).

تصوير شماره 3-1 : کميت سنجي و غلظت سنجي DNA استخراج شده با استفاده از دستگاه NANO DROP
3-5-5- انجام آزمايشات مولکولي:
3-5-5-1- پرايمر ها:
براي اين منظور ابتدا توالي ژن هاي مورد نظر از پايگاه داده ها NCBI استخراج و سپس يک جفت پرايمر اختصاصي براي هر ژن با استفاده از نرم افزار آنلاين Primer3 با آدرس سايتي (http://frodo.wi.mit.edu/primer3) طراحي گرديد. در ادامه ميزان اختصاصي بودن پرايمرها با استفاده از Primer-blast با آدرس اينترنتي (http://www.ncbi.gov/tools/primer-blast )مورد ارزيابي قرار گرفت و به منظور آناليز جهت اطمينان از ساختارهاي ثانويه از نرم افزار oligo analyzer استفاده شد. طبق بررسي هاي به عمل آمده و مرور مطالعات توسط محققين جفت پرايمرهاي مناسب انتخاب و جهت تهيه به شرکت پيشگام سفارش داده شد. پرايمرها مهمترين عامل در موفقيت يا عدم موفقيت واکنشPCR هستند و معمولاً براساس توالي شناخته شده DNA الگو طراحي مي شوند. اگر پرايمرها به طور صحيح طراحي شده باشند واکنش PCR منجر به تکثير قطعه اي از DNA مي شود که با ناحيه هدف مولکول الگو مطابقت دارد و در صورتي که پرايمرها به طور صحيح طراحي نشوند واکنش با شکست روبه رو مي شود. در اين حالت هيچ قطعه اي تکثير نخواهد شد و يا اينکه قطعات اشتباهي تکثير خواهند شد(جدول 3-1).

جدول 3-1- مشخصات پرايمر هاي مورد استفاده
ژن هدف
? (3-5 ) سکانس پرايمر
تعداد نوکلئوتيد
وزن مولکولي
Cnf
F: TTATATAGTCGTCAAGATGGA

R: CACTAAGCTTTACAATATTGA

21
21
639
Pap
F: GAC GGC TGT ACT GCT GGG TGT GGC G

R: ATA TCC TTT CTG CAG GGA TGC AATA

25
25
328
HlyA
F: AACAAGGATAAGCACTGTTCTGGCT

R: ACCATATAAGCGGTCATTCCCGTCA

25
25
1177
Afa
F: GCTGGGCAGCAAACTGATAACTCTC

R: CATCAAGCTGTTTGTTCGTCCGCCG
25
25
750
Fim
F:GAGAAGAGGTTTGATTTAACTTATTG

R: AGAGCCGCTGTAGAACTGAGG
26
21
559
Aer
F: TACCGGATTGTCATATGCAGACCGT

R: AATATCTTCCTCCAGTCCGGAGAAG
25
25
602
3

3-5-5-2-رقيق سازي پرايمرها:
طبق دستور العمل شرکت سازنده براي رقيق سازي هر کدام از پرايمرها طبق فرمول زير عمل شد:
N1V1=N2V2 100(PM) × X=10 (PM) × 100(µL) ? 20(µL)
ابتدا پرايمرهاي موجود براي ژن هاي اختصاصي براي همه ژن هاي ويرولانس (که به صورت ليوفيليزه بودند) طبق دستورالعمل ارسال شده از طرف شرکت پيشگام تا غلظت PMOL/ µL100 با آب مقطر دوبار استريل رقيق شده و به عنوان استوک براي نگهداري طولاني مدت در فريزر20- درجه منتقل شد و محلول کاري با اضافه کردن µL 90 آب مقطر به µL 10 محلول استوک فراهم شد.
3-5-6- PCR
3-5-6-1-بهينه سازي اجزاء واکنش PCR
واکنش PCR در شرايط توصيه شده توسط ساير محققين در دستگاه مستر سايکلر اپندورف گراديانت طبق جدول زير انجام گرديد، اجزا و ترکيبات مورد استفاده براي واکنش PCR براي تمامي 6 ژن يکسان مي باشد (جدول شماره 3-2)

جدول 3-2: اجزاء و ترکيبات مورد استفاده براي واکنش PCR
اجزاي واکنش
غلظت
حجم(ميکروليتر)
مستر ميکسAmpliqon واجد Taq DNA polymerase به همراه بافر) dNTP (2X وکلريد منيزيم
X2
10
پرايمر فوروارد
10 پيکومول/ ميکروليتر
1
پرايمر ريورس
10 پيکومول/ ميکروليتر
1
ژنوم

1
آب مقطر آمپولي استريل

7
حجم نهايي

20

3-5-6-2-بهينه سازي تهيه Master Mix
در ابتدا بدون تهيه رقت از پرايمرها مستر ميکس تهيه شد و به طور تصادفي از ژنوم استخراج شده شماره 23، PCR انجام شد که پس از مراحل الکتروفورز و رنگ آميزي تجمع پرايمر محسوس بود. سپس با تهيه رقت از پرايمر طي چند مرحله، در نهايت رقت 20(pm) و حجم 2(µl) بدست آمد، که با انجام PCR جواب هاي قابل قبولي حاصل شد.

3-5-7- گراديانت دمايي جهت بدست آوردن دماي اتصال براي ژن aer
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 23 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از 69-68-67-66 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 68 درجه در ژن aer استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن aer در( جدول شماره 3-3) آمده است.

جدول 3-3: برنامه دمايي ترموسايکلر براي ژن aer
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°68
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3-5-7-1-گراديانت دمايي جهت بدست آوردن دماي اتصال براي ژن HlyA
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 5 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از 67-66-65-64-63-62-61-60-59-58 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 62 درجه در ژن HlyA استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن HlyA در( جدول شماره 3-4) آمده است.

جدول 3-4: برنامه دمايي ترموسايکلر براي ژن HlyA
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°62
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3-5-7-2- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Pap
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 2 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از72-71-70-69-68-67-66-65-64-63-62-61 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 63 درجه در ژن Pap استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن Pap در( جدول شماره 3-5)آمده است.

جدول 3-5 : برنامه دمايي ترموسايکلر براي ژن Pap
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30

1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°63
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3-5-7-3- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Cnf
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 5 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از59-58-57-56-55-54-53-52-51 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 57 درجه در ژن CNF استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن CNF در( جدول شماره 3-6)آمده است.

جدول 3-6: برنامه دمايي ترموسايکلر براي ژن CNF

مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30

1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°57
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3
3-5-7-4- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Afa
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 1 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از67-66-65-64-63-62-61-60-59-58-57 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 65 درجه در ژن Afa استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود. برنامه دمايي مورد استفاده براي يک واکنشPCR براي ژن Afa در( جدول شماره 3-7)آمده است.

جدول 3-7: برنامه دمايي ترموسايکلر براي ژن ژن Afa
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°65
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

3
3-5-7-5- گراديانت دمايي جهت بدست آوردن دماي اتصال براي Fim
در ابتدا قبل از شروع PCR براي بدست آوردن دماي اتصال گراديانت دمايي انجام گرديد، نمونه مورد نظر براي اين کار نمونه شماره 11 انتخاب گرديد، دماهاي انتخاب شده براي انجام گراديانت دمايي به ترتيب عبارتند از64 -63-62-61-60-59 با هر دو پرايمر فوروارد و ريورس، سپس الکتروفورز انجام گرديد و بعد از مشاهده باندها تصميم گرفته شد که از دماي 59 درجه در ژن Fim استفاده شود چون وضوح باند در هر دو پرايمر فوروارد و ريورس در اين دما بيشتر بود برنامه دمايي مورد استفاده براي يک واکنش PCR براي ژن Fim در( جدول شماره 3-8)آمده است.

جدول 3-8: برنامه دمايي ترموسايکلر براي ژن Fim
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اوليه
C°95
5 دقيقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقيقه

اتصال
C°59
1 دقيقه

گسترش
C°72
1 دقيقه

گسترش نهايي
C°72
7 دقيقه

. 3-6-مراحل انجام PCR
مرحله واسرشتي او
ليه1: در اين مرحله ابتدا با استفاده از حرارت دو رشته DNA از هم باز مي شوند. مطابق با جدول دماي دناتوراسيون C°95 و زمان مورد نياز معمولاً 5دقيقه است.
از اين مرحله به بعد وارد برنامه چرخه اي PCR مي شويم كه خود شامل سه مرحله است:
مرحله واسرشتي2: اين مرحله نيز مانند مرحله واسرشتي اوليه، اما با زماني كوتاهتر از آن انجام مي گيرد. دو رشته DNA بطور كامل در اين مرحله از هم جدا مي شوند. دماي مورد استفاده در اين مرحله 95درجه سلسيوس به مدت 30 ثانيه است.
مرحله اتصال3 :در اين مرحله با پايين آوردن دما و رساندن آن به حد مناسب تلاش مي شود تا پرايمرها بتوانند با رشته مكمل خود در DNA الگو جفت شوند.
مرحله طويل شدن4: دما بايد براي فعاليت آنزيم پليمراز مناسب باشد و در اين مرحله رشته مكمل رشته الگو ساخته خواهد شد و از آنجا كه رشته هاي ساخته شده جديد نيز مكمل آغازگرها هستند، اين چرخه حرارتي مي تواند چندين بار تكرار شود و به همين طريق ساخت و تكثير قطعات ادامه مي يابد. دماي اين مرحله 72 درجه سلسيوس مي باشد كه براي فعاليت آنزيم پليمراز مناسب است.7

3-6-1-بهينه‌سازي PCR
بهينه‌سازي يعني تعيين غلظت‌هاي مناسب مواد واكنشگر و دماي مناسب اتصال پرايمرها (Tm) جهت به دست آوردن محصول PCR مناسب براي اين منظور براي هر يك از پارامترها مثلTm آزمايشات مختلف انجام شد سپس با بررسي محصول و نوع پرايمرها و نيز شرايط واكنش، بهترين دما و سيكل انتخاب گرديد.
به منظور بدست آوردن دماي مناسب براي هر يک از پرايمرها جهت انجام واکنش PCR، نمونه کنترل مثبت را با يک جفت پرايمر گراديانت دمايي گذاشتيم و دماي مناسب هر يک گزارش شد.
عمل بهينه نمودن واكنش با تغييرات جزء به جزء و مرحله به مرحله در غلظت‌هاي DNA الگو، پرايمر، dNTPs، MgCI2، polymerase DNA Taq و بهترين دماي Annealing صورت گرفت تا اينكه شرايط بهينه جهت تكثير ژن‌هاي ويرولانس حاصل آمد.
3-6-2- بررسي محصول PCR
جهت آشكارسازي محصول PCR از روش متداول و سريع الكتروفورز ژل آگاروز و رنگ‌آميزي با اتيديوم برومايد براي آشكارسازي سكانس هدف تكثير يافته استفاده مي‌كنيم.
آگارز پلي ساكاريدي است كه در اثر حرارت در بافر مناسب خود به صورت‌ ژله‌اي با آرايش پليمري منظم و قطر منافذ مشخص در مي‌آيد. اين منافذ امكان عبور ماكرومولكول‌هاي DNA را در ژل آگاروز حين انجام الكتروفورز از قطب منفي (كاتد) به سمت قطب مثبت (آند) فراهم مي‌كند. غلظت بالاتر ژل آگاروز سبب ايجاد منافذ ريزتر مي‌شود كه قدرت تفكيك اندازه ‌DNA کوچکتري را فراهم مي‌كند.
با دانستن طول سكانس هدف، غلظت ژل آگاروز را براي بررسي محصول PCR خود تعيين كرده و ژل مناسب را تهيه نموديم.
حدود 6 ميكروليتر از نمونه‌ها با 5/1 ميكروليتر از بافر لود كننده با غلظت 6 شركت سيناژن، به خوبي مخلوط گرديده و در چاهك‌هاي ژل قرار داده مي‌شدند.
جهت بهينه نمودن الكتروفورز، اين عمل در حالات و شرايط مختلف آزمايش گرديد. بدين منظور انواع آگاروز از شركت‌هاي خارجي از جمله Gibco BRL, Bio Rad, Digma, Roche هم چنين انواع بافرها با غلظت‌ها و نسبت‌هاي مختلف مواد تشكيل دهنده

دیدگاهتان را بنویسید